EMAIL THIS PAGE TO A FRIEND

AKAP2

A kinase (PRKA) anchor protein 2

72 Gene Product Result for
Synonyms: AKAP-2 AKAPKL PRKA2
Gene ID:
Human(11217) Summary: The protein encoded by this gene binds to the regulatory subunit of protein kinase A and is found associated with the actin cytoskeleton. The encoded protein mediates signals carried by cAMP and may be involved in creating polarity in certain signaling processes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(11641) A kinase (PRKA) anchor protein 2
Rat(298024) A kinase (PRKA) anchor protein 2
Zebrafish(100002543) A kinase (PRKA) anchor protein 2
chicken(100533110) A kinase (PRKA) anchor protein 2
cow(614497) A kinase (PRKA) anchor protein 2
domestic cat(101088121) A kinase (PRKA) anchor protein 2
dog(100533100) A kinase (PRKA) anchor protein 2
naked mole-rat(101719133) A kinase (PRKA) anchor protein 2
domestic guinea pig(100714175) A kinase (PRKA) anchor protein 2
sheep(101114239) A kinase (PRKA) anchor protein 2
Domestic Rabbit(100533109) A kinase (PRKA) anchor protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004065 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004065 Rosetta Predictions human pricing
NM_001011974 Rosetta Predictions rat pricing
XM_575832 Rosetta Predictions rat pricing
NM_001035532 Rosetta Predictions mouse pricing
NM_001035533 Rosetta Predictions mouse pricing
NM_009649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094771 predicted 2301
2 SASI_Hs01_00094772 predicted 1894
3 SASI_Hs01_00094773 predicted 1736
4 SASI_Hs02_00304461 predicted 2188
5 SASI_Hs01_00094774 predicted 2020
6 SASI_Hs01_00094775 predicted 608
7 SASI_Hs01_00094776 predicted 1695
8 SASI_Hs01_00094777 predicted 2479
9 SASI_Hs01_00094778 predicted 1613
10 SASI_Hs01_00094779 predicted 1780
11 SASI_Hs01_00094780 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078143 predicted 2353
2 SASI_Rn01_00078144 predicted 2835
3 SASI_Rn01_00078145 predicted 2638
4 SASI_Rn01_00078146 predicted 2867
5 SASI_Rn01_00078147 predicted 1622
6 SASI_Rn01_00078148 predicted 283
7 SASI_Rn02_00199996 predicted 1701
8 SASI_Rn01_00078150 predicted 2750
9 SASI_Rn01_00078151 predicted 2811
10 SASI_Rn01_00078152 predicted 2799
11 SASI_Rn01_00078149 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142676 predicted 2361
2 SASI_Rn01_00142677 predicted 2835
3 SASI_Rn01_00142678 predicted 2647
4 SASI_Rn01_00142679 predicted 2876
5 SASI_Rn01_00142680 predicted 1627
6 SASI_Rn01_00142681 predicted 287
7 SASI_Rn01_00142682 predicted 1371
8 SASI_Rn01_00142683 predicted 2756
9 SASI_Rn01_00142684 predicted 2824
10 SASI_Rn01_00142685 predicted 2804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043441 predicted 2049
2 SASI_Mm01_00043442 predicted 2191
3 SASI_Mm01_00043443 predicted 2069
4 SASI_Mm01_00043444 predicted 1737
5 SASI_Mm01_00043445 predicted 1024
6 SASI_Mm01_00043446 predicted 1835
7 SASI_Mm01_00043447 predicted 2236
8 SASI_Mm01_00043448 predicted 890
9 SASI_Mm01_00043449 predicted 1988
10 SASI_Mm01_00043450 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130970 predicted 2043
2 SASI_Mm01_00130971 predicted 2197
3 SASI_Mm01_00130972 predicted 2069
4 SASI_Mm01_00130973 predicted 1737
5 SASI_Mm01_00130974 predicted 1020
6 SASI_Mm01_00130975 predicted 1835
7 SASI_Mm01_00130976 predicted 2233
8 SASI_Mm01_00130977 predicted 895
9 SASI_Mm01_00130978 predicted 1987
10 SASI_Mm01_00130979 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155323 predicted 2048
2 SASI_Mm01_00155324 predicted 2196
3 SASI_Mm01_00155325 predicted 2061
4 SASI_Mm01_00155326 predicted 1738
5 SASI_Mm01_00155327 predicted 1024
6 SASI_Mm01_00155328 predicted 1834
7 SASI_Mm01_00155329 predicted 2237
8 SASI_Mm01_00155330 predicted 889
9 SASI_Mm01_00155331 predicted 1995
10 SASI_Mm01_00155332 predicted 1820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009649
AKAP2 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-2057s21c1
Sequence:CCGGACTTCAGCATGGACAACATAACTCGAGTTATGTTGTCCATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-3299s21c1
Sequence:CCGGTGTGACAAAGGAGTCAATATACTCGAGTATATTGACTCCTTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-1954s21c1
Sequence:CCGGAGATCGGTCAATGTATCTTTGCTCGAGCAAAGATACATTGACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-2959s21c1
Sequence:CCGGAGAGGAGGACAACGAATAAACCTCGAGGTTTATTCGTTGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1825s1c1
Sequence:CCGGCCATACAGTGAGCCTTCGAAACTCGAGTTTCGAAGGCTCACTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-763s1c1
Sequence:CCGGGCCATACTGGTAAGCAGCTTACTCGAGTAAGCTGCTTACCAGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-2290s1c1
Sequence:CCGGCTGGTGCAGAATGCCATTCAACTCGAGTTGAATGGCATTCTGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-637s1c1
Sequence:CCGGCACGAGTCTTTAGACAACGATCTCGAGATCGTTGTCTAAAGACTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1620s1c1
Sequence:CCGGGCTGTTCTCTATCAAGCCTTACTCGAGTAAGGCTTGATAGAGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009649
AKAP2 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-2057s21c1
Sequence:CCGGACTTCAGCATGGACAACATAACTCGAGTTATGTTGTCCATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-3299s21c1
Sequence:CCGGTGTGACAAAGGAGTCAATATACTCGAGTATATTGACTCCTTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-1954s21c1
Sequence:CCGGAGATCGGTCAATGTATCTTTGCTCGAGCAAAGATACATTGACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-2959s21c1
Sequence:CCGGAGAGGAGGACAACGAATAAACCTCGAGGTTTATTCGTTGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1825s1c1
Sequence:CCGGCCATACAGTGAGCCTTCGAAACTCGAGTTTCGAAGGCTCACTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-763s1c1
Sequence:CCGGGCCATACTGGTAAGCAGCTTACTCGAGTAAGCTGCTTACCAGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-2290s1c1
Sequence:CCGGCTGGTGCAGAATGCCATTCAACTCGAGTTGAATGGCATTCTGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-637s1c1
Sequence:CCGGCACGAGTCTTTAGACAACGATCTCGAGATCGTTGTCTAAAGACTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1620s1c1
Sequence:CCGGGCTGTTCTCTATCAAGCCTTACTCGAGTAAGGCTTGATAGAGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009649
AKAP2 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-2057s21c1
Sequence:CCGGACTTCAGCATGGACAACATAACTCGAGTTATGTTGTCCATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-3299s21c1
Sequence:CCGGTGTGACAAAGGAGTCAATATACTCGAGTATATTGACTCCTTTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009649.2-1954s21c1
Sequence:CCGGAGATCGGTCAATGTATCTTTGCTCGAGCAAAGATACATTGACCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009649.2-2959s21c1
Sequence:CCGGAGAGGAGGACAACGAATAAACCTCGAGGTTTATTCGTTGTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1825s1c1
Sequence:CCGGCCATACAGTGAGCCTTCGAAACTCGAGTTTCGAAGGCTCACTGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-763s1c1
Sequence:CCGGGCCATACTGGTAAGCAGCTTACTCGAGTAAGCTGCTTACCAGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-2290s1c1
Sequence:CCGGCTGGTGCAGAATGCCATTCAACTCGAGTTGAATGGCATTCTGCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-637s1c1
Sequence:CCGGCACGAGTCTTTAGACAACGATCTCGAGATCGTTGTCTAAAGACTCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009649.1-1620s1c1
Sequence:CCGGGCTGTTCTCTATCAAGCCTTACTCGAGTAAGGCTTGATAGAGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004065
VALIDATED
AKAP2 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1547s1c1
Sequence:CCGGCCCTTATCTAAACTGTGGGCTCTCGAGAGCCCACAGTTTAGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2729s1c1
Sequence:CCGGCGCGAGAGAATGGATGATAGTCTCGAGACTATCATCCATTCTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1784s1c1
Sequence:CCGGGCATCCAATGAGACAACCAATCTCGAGATTGGTTGTCTCATTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2365s1c1
Sequence:CCGGCACTCAAGAATCTGACGTGATCTCGAGATCACGTCAGATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-431s1c1
Sequence:CCGGCGCTATCTAGATGAGGTGCTACTCGAGTAGCACCTCATCTAGATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-473s1c1
Sequence:CCGGGCTGTGGATGGAACGTACAATCTCGAGATTGTACGTTCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-4011s1c1
Sequence:CCGGCCAGTGTGTTTCAGGATGATACTCGAGTATCATCCTGAAACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-961s1c1
Sequence:CCGGCGTCAAGAAGAATCCTGGCATCTCGAGATGCCAGGATTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2763s1c1
Sequence:CCGGCCACACGGGTTAATCGAAGAACTCGAGTTCTTCGATTAACCCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1184s1c1
Sequence:CCGGCGCGCAAGCATGATTGACAAACTCGAGTTTGTCAATCATGCTTGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2417s1c1
Sequence:CCGGCAGCGGACTTTGTCCATGATTCTCGAGAATCATGGACAAAGTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1607s1c1
Sequence:CCGGGTGGTCAAGGATGATGACCATCTCGAGATGGTCATCATCCTTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004065
VALIDATED
AKAP2 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1547s1c1
Sequence:CCGGCCCTTATCTAAACTGTGGGCTCTCGAGAGCCCACAGTTTAGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2729s1c1
Sequence:CCGGCGCGAGAGAATGGATGATAGTCTCGAGACTATCATCCATTCTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1784s1c1
Sequence:CCGGGCATCCAATGAGACAACCAATCTCGAGATTGGTTGTCTCATTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2365s1c1
Sequence:CCGGCACTCAAGAATCTGACGTGATCTCGAGATCACGTCAGATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-431s1c1
Sequence:CCGGCGCTATCTAGATGAGGTGCTACTCGAGTAGCACCTCATCTAGATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-473s1c1
Sequence:CCGGGCTGTGGATGGAACGTACAATCTCGAGATTGTACGTTCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-4011s1c1
Sequence:CCGGCCAGTGTGTTTCAGGATGATACTCGAGTATCATCCTGAAACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-961s1c1
Sequence:CCGGCGTCAAGAAGAATCCTGGCATCTCGAGATGCCAGGATTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2763s1c1
Sequence:CCGGCCACACGGGTTAATCGAAGAACTCGAGTTCTTCGATTAACCCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1184s1c1
Sequence:CCGGCGCGCAAGCATGATTGACAAACTCGAGTTTGTCAATCATGCTTGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2417s1c1
Sequence:CCGGCAGCGGACTTTGTCCATGATTCTCGAGAATCATGGACAAAGTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1607s1c1
Sequence:CCGGGTGGTCAAGGATGATGACCATCTCGAGATGGTCATCATCCTTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004065
VALIDATED
AKAP2 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1547s1c1
Sequence:CCGGCCCTTATCTAAACTGTGGGCTCTCGAGAGCCCACAGTTTAGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2729s1c1
Sequence:CCGGCGCGAGAGAATGGATGATAGTCTCGAGACTATCATCCATTCTCTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1784s1c1
Sequence:CCGGGCATCCAATGAGACAACCAATCTCGAGATTGGTTGTCTCATTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2365s1c1
Sequence:CCGGCACTCAAGAATCTGACGTGATCTCGAGATCACGTCAGATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-431s1c1
Sequence:CCGGCGCTATCTAGATGAGGTGCTACTCGAGTAGCACCTCATCTAGATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-473s1c1
Sequence:CCGGGCTGTGGATGGAACGTACAATCTCGAGATTGTACGTTCCATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.3-4011s1c1
Sequence:CCGGCCAGTGTGTTTCAGGATGATACTCGAGTATCATCCTGAAACACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-961s1c1
Sequence:CCGGCGTCAAGAAGAATCCTGGCATCTCGAGATGCCAGGATTCTTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-2763s1c1
Sequence:CCGGCCACACGGGTTAATCGAAGAACTCGAGTTCTTCGATTAACCCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-1184s1c1
Sequence:CCGGCGCGCAAGCATGATTGACAAACTCGAGTTTGTCAATCATGCTTGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001004065.2-2417s1c1
Sequence:CCGGCAGCGGACTTTGTCCATGATTCTCGAGAATCATGGACAAAGTCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004065.2-1607s1c1
Sequence:CCGGGTGGTCAAGGATGATGACCATCTCGAGATGGTCATCATCCTTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks