EMAIL THIS PAGE TO A FRIEND

AKAP3

A kinase (PRKA) anchor protein 3

Synonyms: AKAP 110 AKAP110 CT82 FSP95 PRKA3 SOB1
UniProtKB ID: O75969, O75945, Q86X01, Q9UM61
Gene ID:
Human(10566) Summary: This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Mouse(11642) A kinase (PRKA) anchor protein 3
Rat(312720) A kinase (PRKA) anchor protein 3
dog(477719) A kinase (PRKA) anchor protein 3
cow(281610) A kinase (PRKA) anchor protein 3
domestic cat(101092617) A kinase (PRKA) anchor protein 3
sheep(101116040) A kinase (PRKA) anchor protein 3
Domestic Rabbit(100351409) A kinase (PRKA) anchor protein 3
domestic guinea pig(100731430) A kinase (PRKA) anchor protein 3
naked mole-rat(101725152) A kinase (PRKA) anchor protein 3
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006422 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042551 MISSION® esiRNA esiRNA human AKAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006422 Rosetta Predictions human pricing
NM_001005557 Rosetta Predictions rat pricing
NM_009650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341540 predicted 1335
2 SASI_Hs01_00086650 predicted 2201
3 SASI_Hs01_00086652 predicted 2423
4 SASI_Hs01_00086653 predicted 1688
5 SASI_Hs02_00341541 predicted 1427
6 SASI_Hs01_00086654 predicted 259
7 SASI_Hs01_00086655 predicted 2086
8 SASI_Hs01_00086656 predicted 595
9 SASI_Hs01_00086657 predicted 1891
10 SASI_Hs01_00086658 predicted 1169
11 SASI_Hs01_00086651 predicted 690
12 SASI_Hs01_00086659 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073926 predicted 524
2 SASI_Rn01_00073927 predicted 1428
3 SASI_Rn01_00073928 predicted 2474
4 SASI_Rn01_00073929 predicted 360
5 SASI_Rn01_00073930 predicted 423
6 SASI_Rn01_00073931 predicted 541
7 SASI_Rn01_00073932 predicted 797
8 SASI_Rn01_00073933 predicted 647
9 SASI_Rn01_00073934 predicted 780
10 SASI_Rn01_00073935 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316637 predicted 2433
2 SASI_Mm02_00316638 predicted 1971
3 SASI_Mm01_00066518 predicted 2759
4 SASI_Mm01_00066520 predicted 2252
5 SASI_Mm01_00066521 predicted 823
6 SASI_Mm01_00066522 predicted 694
7 SASI_Mm01_00066523 predicted 2422
8 SASI_Mm02_00316639 predicted 987
9 SASI_Mm01_00066524 predicted 1695
10 SASI_Mm01_00066527 predicted 733
11 SASI_Mm01_00066519 predicted 918
12 SASI_Mm01_00066525 predicted 851
13 SASI_Mm01_00066526 predicted 2109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009650
AKAP3 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-623s1c1
Sequence:CCGGGCCTCATTTCCCATGTTGGTACTCGAGTACCAACATGGGAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2449s1c1
Sequence:CCGGGCCTTCCCAGATAACTTATATCTCGAGATATAAGTTATCTGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2301s1c1
Sequence:CCGGCCAGCTAGACAACTGTATGAACTCGAGTTCATACAGTTGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2297s1c1
Sequence:CCGGCCAACCAGCTAGACAACTGTACTCGAGTACAGTTGTCTAGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-993s1c1
Sequence:CCGGCGGCACTAAGAAGTCTTTCTTCTCGAGAAGAAAGACTTCTTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2172s21c1
Sequence:CCGGTTACTCAGCGAGACCATATTCCTCGAGGAATATGGTCTCGCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2276s21c1
Sequence:CCGGTCCATGTGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-722s21c1
Sequence:CCGGGGGTTCCATAGACGAAGTTTCCTCGAGGAAACTTCGTCTATGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-1563s21c1
Sequence:CCGGAGGGACAAGTCGGAGAGTTACCTCGAGGTAACTCTCCGACTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009650
AKAP3 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-623s1c1
Sequence:CCGGGCCTCATTTCCCATGTTGGTACTCGAGTACCAACATGGGAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2449s1c1
Sequence:CCGGGCCTTCCCAGATAACTTATATCTCGAGATATAAGTTATCTGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2301s1c1
Sequence:CCGGCCAGCTAGACAACTGTATGAACTCGAGTTCATACAGTTGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2297s1c1
Sequence:CCGGCCAACCAGCTAGACAACTGTACTCGAGTACAGTTGTCTAGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-993s1c1
Sequence:CCGGCGGCACTAAGAAGTCTTTCTTCTCGAGAAGAAAGACTTCTTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2172s21c1
Sequence:CCGGTTACTCAGCGAGACCATATTCCTCGAGGAATATGGTCTCGCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2276s21c1
Sequence:CCGGTCCATGTGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-722s21c1
Sequence:CCGGGGGTTCCATAGACGAAGTTTCCTCGAGGAAACTTCGTCTATGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-1563s21c1
Sequence:CCGGAGGGACAAGTCGGAGAGTTACCTCGAGGTAACTCTCCGACTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009650
AKAP3 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-623s1c1
Sequence:CCGGGCCTCATTTCCCATGTTGGTACTCGAGTACCAACATGGGAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2449s1c1
Sequence:CCGGGCCTTCCCAGATAACTTATATCTCGAGATATAAGTTATCTGGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2301s1c1
Sequence:CCGGCCAGCTAGACAACTGTATGAACTCGAGTTCATACAGTTGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-2297s1c1
Sequence:CCGGCCAACCAGCTAGACAACTGTACTCGAGTACAGTTGTCTAGCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009650.1-993s1c1
Sequence:CCGGCGGCACTAAGAAGTCTTTCTTCTCGAGAAGAAAGACTTCTTAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2172s21c1
Sequence:CCGGTTACTCAGCGAGACCATATTCCTCGAGGAATATGGTCTCGCTGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-2276s21c1
Sequence:CCGGTCCATGTGAAAGGCCTATTACCTCGAGGTAATAGGCCTTTCACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-722s21c1
Sequence:CCGGGGGTTCCATAGACGAAGTTTCCTCGAGGAAACTTCGTCTATGGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009650.2-1563s21c1
Sequence:CCGGAGGGACAAGTCGGAGAGTTACCTCGAGGTAACTCTCCGACTTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006422
AKAP3 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2141s1c1
Sequence:CCGGCCCAGGCTATATGAGGATGATCTCGAGATCATCCTCATATAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2266s1c1
Sequence:CCGGGCTGTGTGTCATCATTGCTAACTCGAGTTAGCAATGATGACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1089s1c1
Sequence:CCGGCCTATGCTAACAGTGTGGTATCTCGAGATACCACACTGTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-504s1c1
Sequence:CCGGGCACTCCAGAAAGATTGCATTCTCGAGAATGCAATCTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1820s1c1
Sequence:CCGGGCCCTGCTTCTGATTCAATATCTCGAGATATTGAATCAGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-466s21c1
Sequence:CCGGAGGTTTCTCTGTAGACTATTACTCGAGTAATAGTCTACAGAGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-1710s21c1
Sequence:CCGGTTGAGTACCCTGAAGATATTGCTCGAGCAATATCTTCAGGGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006422
AKAP3 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2141s1c1
Sequence:CCGGCCCAGGCTATATGAGGATGATCTCGAGATCATCCTCATATAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2266s1c1
Sequence:CCGGGCTGTGTGTCATCATTGCTAACTCGAGTTAGCAATGATGACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1089s1c1
Sequence:CCGGCCTATGCTAACAGTGTGGTATCTCGAGATACCACACTGTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-504s1c1
Sequence:CCGGGCACTCCAGAAAGATTGCATTCTCGAGAATGCAATCTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1820s1c1
Sequence:CCGGGCCCTGCTTCTGATTCAATATCTCGAGATATTGAATCAGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-466s21c1
Sequence:CCGGAGGTTTCTCTGTAGACTATTACTCGAGTAATAGTCTACAGAGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-1710s21c1
Sequence:CCGGTTGAGTACCCTGAAGATATTGCTCGAGCAATATCTTCAGGGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006422
AKAP3 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2141s1c1
Sequence:CCGGCCCAGGCTATATGAGGATGATCTCGAGATCATCCTCATATAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-2266s1c1
Sequence:CCGGGCTGTGTGTCATCATTGCTAACTCGAGTTAGCAATGATGACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1089s1c1
Sequence:CCGGCCTATGCTAACAGTGTGGTATCTCGAGATACCACACTGTTAGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-504s1c1
Sequence:CCGGGCACTCCAGAAAGATTGCATTCTCGAGAATGCAATCTTTCTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006422.2-1820s1c1
Sequence:CCGGGCCCTGCTTCTGATTCAATATCTCGAGATATTGAATCAGAAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-466s21c1
Sequence:CCGGAGGTTTCTCTGTAGACTATTACTCGAGTAATAGTCTACAGAGAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006422.2-1710s21c1
Sequence:CCGGTTGAGTACCCTGAAGATATTGCTCGAGCAATATCTTCAGGGTACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks