EMAIL THIS PAGE TO A FRIEND

AKAP4

A kinase (PRKA) anchor protein 4

86 Gene Product Result for
Synonyms: AKAP 82 AKAP-4 AKAP82 CT99 FSC1 HI PRKA4 hAKAP82 p82
Gene ID:
Human(8852) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is localized to the sperm flagellum and may be involved in the regulation of sperm motility. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11643) A kinase (PRKA) anchor protein 4
Rat(79254) A kinase (PRKA) anchor protein 4
naked mole-rat(101726276) A kinase (PRKA) anchor protein 4
domestic guinea pig(100713980) A kinase (PRKA) anchor protein 4
sheep(101102535) A kinase (PRKA) anchor protein 4
cow(281611) A kinase (PRKA) anchor protein 4
dog(480917) A kinase (PRKA) anchor protein 4
domestic cat(101081524) A kinase (PRKA) anchor protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003886 Rosetta Predictions human pricing
NM_139289 Rosetta Predictions human pricing
NM_024402 Rosetta Predictions rat pricing
XM_579492 Rosetta Predictions rat pricing
NM_001042542 Rosetta Predictions mouse pricing
NM_009651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147272 predicted 1272
2 SASI_Hs01_00147273 predicted 1851
3 SASI_Hs02_00336498 predicted 2215
4 SASI_Hs01_00147274 predicted 2241
5 SASI_Hs01_00147275 predicted 2566
6 SASI_Hs01_00147276 predicted 1128
7 SASI_Hs01_00147277 predicted 2020
8 SASI_Hs01_00147279 predicted 768
9 SASI_Hs01_00147280 predicted 2008
10 SASI_Hs01_00147281 predicted 769
11 SASI_Hs01_00147278 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150645 predicted 1249
2 SASI_Hs01_00150646 predicted 1815
3 SASI_Hs02_00364277 predicted 2190
4 SASI_Hs01_00150647 predicted 2219
5 SASI_Hs01_00150648 predicted 2542
6 SASI_Hs01_00150649 predicted 1099
7 SASI_Hs01_00150650 predicted 1987
8 SASI_Hs01_00150652 predicted 741
9 SASI_Hs01_00150653 predicted 1983
10 SASI_Hs01_00150654 predicted 738
11 SASI_Hs01_00150651 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034604 predicted 1200
2 SASI_Rn01_00034605 predicted 1828
3 SASI_Rn01_00034606 predicted 1370
4 SASI_Rn01_00034607 predicted 737
5 SASI_Rn01_00034608 predicted 1074
6 SASI_Rn01_00034609 predicted 884
7 SASI_Rn01_00034610 predicted 625
8 SASI_Rn01_00034611 predicted 2125
9 SASI_Rn01_00034612 predicted 1680
10 SASI_Rn01_00034613 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181370 predicted 1200
2 SASI_Rn01_00181371 predicted 1425
3 SASI_Rn01_00181372 predicted 1376
4 SASI_Rn01_00181373 predicted 1191
5 SASI_Rn01_00181374 predicted 1070
6 SASI_Rn01_00181375 predicted 1457
7 SASI_Rn01_00181376 predicted 1446
8 SASI_Rn01_00181377 predicted 1049
9 SASI_Rn01_00181378 predicted 1179
10 SASI_Rn01_00181379 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290575 predicted 1900
2 SASI_Mm02_00290576 predicted 350
3 SASI_Mm02_00290577 predicted 1491
4 SASI_Mm02_00290578 predicted 798
5 SASI_Mm02_00290579 predicted 941
6 SASI_Mm02_00290580 predicted 2321
7 SASI_Mm02_00290581 predicted 2308
8 SASI_Mm02_00290582 predicted 2546
9 SASI_Mm02_00290583 predicted 1857
10 SASI_Mm02_00290584 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118056 predicted 1895
2 SASI_Mm02_00316640 predicted 345
3 SASI_Mm02_00316641 predicted 1479
4 SASI_Mm01_00118058 predicted 792
5 SASI_Mm01_00118060 predicted 943
6 SASI_Mm02_00316642 predicted 2322
7 SASI_Mm02_00316643 predicted 2307
8 SASI_Mm02_00316644 predicted 2535
9 SASI_Mm02_00316645 predicted 1848
10 SASI_Mm02_00316646 predicted 638
11 SASI_Mm01_00118055 predicted 1278
12 SASI_Mm01_00118057 predicted 1451
13 SASI_Mm01_00118059 predicted 1142
14 SASI_Mm01_00118061 predicted 828
15 SASI_Mm01_00118062 predicted 2188
16 SASI_Mm01_00118063 predicted 702
17 SASI_Mm01_00118064 predicted 2203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009651
AKAP4 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-417s21c1
Sequence:CCGGAGCTCCCTCTGATCCTATAAGCTCGAGCTTATAGGATCAGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-533s21c1
Sequence:CCGGGAGACCTAGAGGGTGACTATACTCGAGTATAGTCACCCTCTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1467s21c1
Sequence:CCGGTGGAACTAATGATCCGAAATGCTCGAGCATTTCGGATCATTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1242s21c1
Sequence:CCGGTGTATCTGATCTGATTGATTCCTCGAGGAATCAATCAGATCAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-186s1c1
Sequence:CCGGGACAACAAGATCAGGACCGAACTCGAGTTCGGTCCTGATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-931s1c1
Sequence:CCGGCTCATCAGAAATGCGTGGCAACTCGAGTTGCCACGCATTTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2468s1c1
Sequence:CCGGCAACTAGAGAAGCTCCCTGAACTCGAGTTCAGGGAGCTTCTCTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-1748s1c1
Sequence:CCGGCAATACCATCTGACCCAACAACTCGAGTTGTTGGGTCAGATGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2162s1c1
Sequence:CCGGCGGCAGTTTATAGACCAACTACTCGAGTAGTTGGTCTATAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009651
AKAP4 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-417s21c1
Sequence:CCGGAGCTCCCTCTGATCCTATAAGCTCGAGCTTATAGGATCAGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-533s21c1
Sequence:CCGGGAGACCTAGAGGGTGACTATACTCGAGTATAGTCACCCTCTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1467s21c1
Sequence:CCGGTGGAACTAATGATCCGAAATGCTCGAGCATTTCGGATCATTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1242s21c1
Sequence:CCGGTGTATCTGATCTGATTGATTCCTCGAGGAATCAATCAGATCAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-186s1c1
Sequence:CCGGGACAACAAGATCAGGACCGAACTCGAGTTCGGTCCTGATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-931s1c1
Sequence:CCGGCTCATCAGAAATGCGTGGCAACTCGAGTTGCCACGCATTTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2468s1c1
Sequence:CCGGCAACTAGAGAAGCTCCCTGAACTCGAGTTCAGGGAGCTTCTCTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-1748s1c1
Sequence:CCGGCAATACCATCTGACCCAACAACTCGAGTTGTTGGGTCAGATGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2162s1c1
Sequence:CCGGCGGCAGTTTATAGACCAACTACTCGAGTAGTTGGTCTATAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009651
AKAP4 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-417s21c1
Sequence:CCGGAGCTCCCTCTGATCCTATAAGCTCGAGCTTATAGGATCAGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-533s21c1
Sequence:CCGGGAGACCTAGAGGGTGACTATACTCGAGTATAGTCACCCTCTAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1467s21c1
Sequence:CCGGTGGAACTAATGATCCGAAATGCTCGAGCATTTCGGATCATTAGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009651.3-1242s21c1
Sequence:CCGGTGTATCTGATCTGATTGATTCCTCGAGGAATCAATCAGATCAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-186s1c1
Sequence:CCGGGACAACAAGATCAGGACCGAACTCGAGTTCGGTCCTGATCTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-931s1c1
Sequence:CCGGCTCATCAGAAATGCGTGGCAACTCGAGTTGCCACGCATTTCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2468s1c1
Sequence:CCGGCAACTAGAGAAGCTCCCTGAACTCGAGTTCAGGGAGCTTCTCTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-1748s1c1
Sequence:CCGGCAATACCATCTGACCCAACAACTCGAGTTGTTGGGTCAGATGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009651.1-2162s1c1
Sequence:CCGGCGGCAGTTTATAGACCAACTACTCGAGTAGTTGGTCTATAAACTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003886
VALIDATED
AKAP4 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003886.2-2697s21c1
Sequence:CCGGCTTGACTCCTCTTCATCTTAGCTCGAGCTAAGATGAAGAGGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2302s21c1
Sequence:CCGGACAAGCAGCCTCGGCAAATAACTCGAGTTATTTGCCGAGGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2247s21c1
Sequence:CCGGGCCTTATCATGGCTAAGTATACTCGAGTATACTTAGCCATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-2193s21c1
Sequence:CCGGAGCAAGCGAACGGGCAATTTACTCGAGTAAATTGCCCGTTCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-1999s21c1
Sequence:CCGGTATGTCAAACATCGTTCTAATCTCGAGATTAGAACGATGTTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2310s1c1
Sequence:CCGGCCTCGGCAAATAAGCCCAATTCTCGAGAATTGGGCTTATTTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-602s1c1
Sequence:CCGGGCCGATCAAGTGAACATAGATCTCGAGATCTATGTTCACTTGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-935s1c1
Sequence:CCGGGCTTCTGAAATGGCCTATGAACTCGAGTTCATAGGCCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-478s1c1
Sequence:CCGGCCAGAAGTATGCCTTGGGTTTCTCGAGAAACCCAAGGCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2242s1c1
Sequence:CCGGGCTCTGCCTTATCATGGCTAACTCGAGTTAGCCATGATAAGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003886
VALIDATED
AKAP4 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003886.2-2697s21c1
Sequence:CCGGCTTGACTCCTCTTCATCTTAGCTCGAGCTAAGATGAAGAGGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2302s21c1
Sequence:CCGGACAAGCAGCCTCGGCAAATAACTCGAGTTATTTGCCGAGGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2247s21c1
Sequence:CCGGGCCTTATCATGGCTAAGTATACTCGAGTATACTTAGCCATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-2193s21c1
Sequence:CCGGAGCAAGCGAACGGGCAATTTACTCGAGTAAATTGCCCGTTCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-1999s21c1
Sequence:CCGGTATGTCAAACATCGTTCTAATCTCGAGATTAGAACGATGTTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2310s1c1
Sequence:CCGGCCTCGGCAAATAAGCCCAATTCTCGAGAATTGGGCTTATTTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-602s1c1
Sequence:CCGGGCCGATCAAGTGAACATAGATCTCGAGATCTATGTTCACTTGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-935s1c1
Sequence:CCGGGCTTCTGAAATGGCCTATGAACTCGAGTTCATAGGCCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-478s1c1
Sequence:CCGGCCAGAAGTATGCCTTGGGTTTCTCGAGAAACCCAAGGCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2242s1c1
Sequence:CCGGGCTCTGCCTTATCATGGCTAACTCGAGTTAGCCATGATAAGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003886
VALIDATED
AKAP4 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003886.2-2697s21c1
Sequence:CCGGCTTGACTCCTCTTCATCTTAGCTCGAGCTAAGATGAAGAGGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2302s21c1
Sequence:CCGGACAAGCAGCCTCGGCAAATAACTCGAGTTATTTGCCGAGGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003886.2-2247s21c1
Sequence:CCGGGCCTTATCATGGCTAAGTATACTCGAGTATACTTAGCCATGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-2193s21c1
Sequence:CCGGAGCAAGCGAACGGGCAATTTACTCGAGTAAATTGCCCGTTCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003886.2-1999s21c1
Sequence:CCGGTATGTCAAACATCGTTCTAATCTCGAGATTAGAACGATGTTTGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2310s1c1
Sequence:CCGGCCTCGGCAAATAAGCCCAATTCTCGAGAATTGGGCTTATTTGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-602s1c1
Sequence:CCGGGCCGATCAAGTGAACATAGATCTCGAGATCTATGTTCACTTGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-935s1c1
Sequence:CCGGGCTTCTGAAATGGCCTATGAACTCGAGTTCATAGGCCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-478s1c1
Sequence:CCGGCCAGAAGTATGCCTTGGGTTTCTCGAGAAACCCAAGGCATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003886.2-2242s1c1
Sequence:CCGGGCTCTGCCTTATCATGGCTAACTCGAGTTAGCCATGATAAGGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks