EMAIL THIS PAGE TO A FRIEND

AKAP5

A kinase (PRKA) anchor protein 5

59 Gene Product Result for
Synonyms: AKAP75 AKAP79 H21
UniProtKB ID: P24588, A2RRB8
Gene ID:
Human(9495) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to the RII-beta regulatory subunit of PKA, and also to protein kinase C and the phosphatase calcineurin. It is predominantly expressed in cerebral cortex and may anchor the PKA protein at postsynaptic densities (PSD) and be involved in the regulation of postsynaptic events. It is also expressed in T lymphocytes and may function to inhibit interleukin-2 transcription by disrupting calcineurin-dependent dephosphorylation of NFAT. [provided by RefSeq, Jul 2008]
Mouse(238276) A kinase (PRKA) anchor protein 5
Rat(171026) A kinase (PRKA) anchor protein 5
chicken(423506) A kinase (PRKA) anchor protein 5
cow(281612) A kinase (PRKA) anchor protein 5
domestic cat(101087070) A kinase (PRKA) anchor protein 5
dog(480354) A kinase (PRKA) anchor protein 5
chicken(428917) A kinase (PRKA) anchor protein 5
sheep(101109277) A kinase (PRKA) anchor protein 5
domestic guinea pig(100717568) A kinase (PRKA) anchor protein 5
naked mole-rat(101707046) A kinase (PRKA) anchor protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_138063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_138063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_138063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004857 Rosetta Predictions human pricing
NM_133515 Rosetta Predictions rat pricing
NM_001101471 Rosetta Predictions mouse pricing
XM_138063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135520 predicted 904
2 SASI_Hs02_00338462 predicted 1511
3 SASI_Hs01_00135522 predicted 1214
4 SASI_Hs01_00135523 predicted 1369
5 SASI_Hs02_00338463 predicted 1745
6 SASI_Hs02_00338464 predicted 1740
7 SASI_Hs01_00135524 predicted 470
8 SASI_Hs01_00135525 predicted 625
9 SASI_Hs01_00135526 predicted 1008
10 SASI_Hs01_00135528 predicted 1385
11 SASI_Hs01_00135521 predicted 1971
12 SASI_Hs01_00135527 predicted 1874
13 SASI_Hs01_00135529 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107745 predicted 2383
2 SASI_Rn01_00107746 predicted 2318
3 SASI_Rn02_00267695 predicted 1356
4 SASI_Rn01_00107747 predicted 1056
5 SASI_Rn01_00107748 predicted 1240
6 SASI_Rn01_00107749 predicted 1193
7 SASI_Rn01_00107751 predicted 2391
8 SASI_Rn01_00107752 predicted 1723
9 SASI_Rn01_00107753 predicted 1395
10 SASI_Rn01_00107754 predicted 1940
11 SASI_Rn01_00107750 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302427 predicted 2540
2 SASI_Mm02_00302428 predicted 2345
3 SASI_Mm02_00302429 predicted 2461
4 SASI_Mm02_00302430 predicted 2366
5 SASI_Mm02_00302431 predicted 1458
6 SASI_Mm02_00302432 predicted 758
7 SASI_Mm02_00302433 predicted 1140
8 SASI_Mm02_00302434 predicted 2316
9 SASI_Mm02_00302435 predicted 1151
10 SASI_Mm02_00302436 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227570 predicted 1299
2 SASI_Mm01_00227571 predicted 358
3 SASI_Mm01_00227572 predicted 955
4 SASI_Mm01_00227573 predicted 414
5 SASI_Mm01_00227574 predicted 798
6 SASI_Mm01_00227575 predicted 560
7 SASI_Mm01_00227576 predicted 722
8 SASI_Mm01_00227577 predicted 493
9 SASI_Mm01_00227578 predicted 1013
10 SASI_Mm01_00227579 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_138063
AKAP5 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_138063.4-2823s1c1
Sequence:CCGGCCCATCTGTGAGTGAACCTTTCTCGAGAAAGGTTCACTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-606s1c1
Sequence:CCGGGATCGCCATAGAACTGGAATTCTCGAGAATTCCAGTTCTATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-610s1c1
Sequence:CCGGGCCATAGAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-1447s1c1
Sequence:CCGGGCTACAGTTGATTGGGCAGAACTCGAGTTCTGCCCAATCAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-2151s1c1
Sequence:CCGGCGTCAAGAATGCTATCGAGTTCTCGAGAACTCGATAGCATTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_138063
AKAP5 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_138063.4-2823s1c1
Sequence:CCGGCCCATCTGTGAGTGAACCTTTCTCGAGAAAGGTTCACTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-606s1c1
Sequence:CCGGGATCGCCATAGAACTGGAATTCTCGAGAATTCCAGTTCTATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-610s1c1
Sequence:CCGGGCCATAGAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-1447s1c1
Sequence:CCGGGCTACAGTTGATTGGGCAGAACTCGAGTTCTGCCCAATCAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-2151s1c1
Sequence:CCGGCGTCAAGAATGCTATCGAGTTCTCGAGAACTCGATAGCATTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_138063
AKAP5 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_138063.4-2823s1c1
Sequence:CCGGCCCATCTGTGAGTGAACCTTTCTCGAGAAAGGTTCACTCACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-606s1c1
Sequence:CCGGGATCGCCATAGAACTGGAATTCTCGAGAATTCCAGTTCTATGGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-610s1c1
Sequence:CCGGGCCATAGAACTGGAATTAGAACTCGAGTTCTAATTCCAGTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-1447s1c1
Sequence:CCGGGCTACAGTTGATTGGGCAGAACTCGAGTTCTGCCCAATCAACTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138063.4-2151s1c1
Sequence:CCGGCGTCAAGAATGCTATCGAGTTCTCGAGAACTCGATAGCATTCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004857
VALIDATED
AKAP5 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1825s1c1
Sequence:CCGGCCAGGATCTAAGTGAAGGCATCTCGAGATGCCTTCACTTAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1332s1c1
Sequence:CCGGAGAAGAGATCAGCAGAAGGTACTCGAGTACCTTCTGCTGATCTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2522s1c1
Sequence:CCGGGTTAATGAAATGGCCTCTGATCTCGAGATCAGAGGCCATTTCATTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1814s1c1
Sequence:CCGGGCTAAGTCAACCCAGGATCTACTCGAGTAGATCCTGGGTTGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2071s1c1
Sequence:CCGGACTTTCTGATGTTCCTCCTTTCTCGAGAAAGGAGGAACATCAGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004857.3-1382s21c1
Sequence:CCGGTGGAGCCAATTGCTATTATTACTCGAGTAATAATAGCAATTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1011s21c1
Sequence:CCGGAGTAGAACTTGGATTAGATAACTCGAGTTATCTAATCCAAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004857.3-3920s21c1
Sequence:CCGGTGAACCAAATCATGGATATTACTCGAGTAATATCCATGATTTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1146s21c1
Sequence:CCGGCCATCAGCAGCCAGTACTTTCCTCGAGGAAAGTACTGGCTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1228s21c1
Sequence:CCGGACCCTAGAAAGTGCACCAAATCTCGAGATTTGGTGCACTTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004857
VALIDATED
AKAP5 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1825s1c1
Sequence:CCGGCCAGGATCTAAGTGAAGGCATCTCGAGATGCCTTCACTTAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1332s1c1
Sequence:CCGGAGAAGAGATCAGCAGAAGGTACTCGAGTACCTTCTGCTGATCTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2522s1c1
Sequence:CCGGGTTAATGAAATGGCCTCTGATCTCGAGATCAGAGGCCATTTCATTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1814s1c1
Sequence:CCGGGCTAAGTCAACCCAGGATCTACTCGAGTAGATCCTGGGTTGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2071s1c1
Sequence:CCGGACTTTCTGATGTTCCTCCTTTCTCGAGAAAGGAGGAACATCAGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004857.3-1382s21c1
Sequence:CCGGTGGAGCCAATTGCTATTATTACTCGAGTAATAATAGCAATTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1011s21c1
Sequence:CCGGAGTAGAACTTGGATTAGATAACTCGAGTTATCTAATCCAAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004857.3-3920s21c1
Sequence:CCGGTGAACCAAATCATGGATATTACTCGAGTAATATCCATGATTTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1146s21c1
Sequence:CCGGCCATCAGCAGCCAGTACTTTCCTCGAGGAAAGTACTGGCTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1228s21c1
Sequence:CCGGACCCTAGAAAGTGCACCAAATCTCGAGATTTGGTGCACTTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004857
VALIDATED
AKAP5 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1825s1c1
Sequence:CCGGCCAGGATCTAAGTGAAGGCATCTCGAGATGCCTTCACTTAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1332s1c1
Sequence:CCGGAGAAGAGATCAGCAGAAGGTACTCGAGTACCTTCTGCTGATCTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2522s1c1
Sequence:CCGGGTTAATGAAATGGCCTCTGATCTCGAGATCAGAGGCCATTTCATTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-1814s1c1
Sequence:CCGGGCTAAGTCAACCCAGGATCTACTCGAGTAGATCCTGGGTTGACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004857.x-2071s1c1
Sequence:CCGGACTTTCTGATGTTCCTCCTTTCTCGAGAAAGGAGGAACATCAGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004857.3-1382s21c1
Sequence:CCGGTGGAGCCAATTGCTATTATTACTCGAGTAATAATAGCAATTGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1011s21c1
Sequence:CCGGAGTAGAACTTGGATTAGATAACTCGAGTTATCTAATCCAAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004857.3-3920s21c1
Sequence:CCGGTGAACCAAATCATGGATATTACTCGAGTAATATCCATGATTTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1146s21c1
Sequence:CCGGCCATCAGCAGCCAGTACTTTCCTCGAGGAAAGTACTGGCTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_004857.3-1228s21c1
Sequence:CCGGACCCTAGAAAGTGCACCAAATCTCGAGATTTGGTGCACTTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101471
AKAP5 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2311s21c1
Sequence:CCGGAGCCAATTGCTATTATCATTACTCGAGTAATGATAATAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101471.1-2883s21c1
Sequence:CCGGTGAGCACTGGGTATGCTATATCTCGAGATATAGCATACCCAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2463s21c1
Sequence:CCGGCAGTATGAAACACTCTTAATACTCGAGTATTAAGAGTGTTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-1139s21c1
Sequence:CCGGAGCAACCACACATCAACATAGCTCGAGCTATGTTGATGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101471
AKAP5 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2311s21c1
Sequence:CCGGAGCCAATTGCTATTATCATTACTCGAGTAATGATAATAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101471.1-2883s21c1
Sequence:CCGGTGAGCACTGGGTATGCTATATCTCGAGATATAGCATACCCAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2463s21c1
Sequence:CCGGCAGTATGAAACACTCTTAATACTCGAGTATTAAGAGTGTTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-1139s21c1
Sequence:CCGGAGCAACCACACATCAACATAGCTCGAGCTATGTTGATGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101471
AKAP5 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2311s21c1
Sequence:CCGGAGCCAATTGCTATTATCATTACTCGAGTAATGATAATAGCAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101471.1-2883s21c1
Sequence:CCGGTGAGCACTGGGTATGCTATATCTCGAGATATAGCATACCCAGTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-2463s21c1
Sequence:CCGGCAGTATGAAACACTCTTAATACTCGAGTATTAAGAGTGTTTCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101471.1-1139s21c1
Sequence:CCGGAGCAACCACACATCAACATAGCTCGAGCTATGTTGATGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks