EMAIL THIS PAGE TO A FRIEND

AKAP6

A kinase (PRKA) anchor protein 6

229 Gene Product Result for
Synonyms: ADAP100 ADAP6 AKAP100 PRKA6 mAKAP
UniProtKB ID: Q13023, A7E2D4, O15028
Gene ID:
Human(9472) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(238161) A kinase (PRKA) anchor protein 6
Rat(64553) A kinase (PRKA) anchor protein 6
naked mole-rat(101720403) A kinase (PRKA) anchor protein 6
domestic guinea pig(100725038) A kinase (PRKA) anchor protein 6
sheep(101117111) A kinase (PRKA) anchor protein 6
Domestic Rabbit(100353954) A kinase (PRKA) anchor protein 6
Zebrafish(100002625) A kinase (PRKA) anchor protein 6
cow(537810) A kinase (PRKA) anchor protein 6
Horse(100056405) A kinase (PRKA) anchor protein 6
domestic cat(101088495) A kinase (PRKA) anchor protein 6
dog(490644) A kinase (PRKA) anchor protein 6
chicken(423314) A kinase (PRKA) anchor protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004274 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004274 Rosetta Predictions human pricing
NM_022618 Rosetta Predictions rat pricing
NM_198111 Rosetta Predictions mouse pricing
XM_885325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031489 predicted 787
2 SASI_Hs01_00031490 predicted 4717
3 SASI_Hs01_00031492 predicted 1054
4 SASI_Hs01_00031493 predicted 5253
5 SASI_Hs01_00031494 predicted 509
6 SASI_Hs01_00031495 predicted 3889
7 SASI_Hs01_00031496 predicted 4059
8 SASI_Hs02_00337255 predicted 659
9 SASI_Hs01_00031498 predicted 5931
10 SASI_Hs02_00337256 predicted 415
11 SASI_Hs01_00031491 predicted 4531
12 SASI_Hs01_00031497 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066418 predicted 3927
2 SASI_Rn02_00263393 predicted 4051
3 SASI_Rn01_00066419 predicted 3794
4 SASI_Rn01_00066420 predicted 7013
5 SASI_Rn01_00066421 predicted 5759
6 SASI_Rn01_00066422 predicted 1611
7 SASI_Rn01_00066423 predicted 3468
8 SASI_Rn02_00263394 predicted 7043
9 SASI_Rn01_00066424 predicted 7058
10 SASI_Rn01_00066425 predicted 2951
11 SASI_Rn01_00066426 predicted 2412
12 SASI_Rn01_00066427 predicted 4797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350849 predicted 3750
2 SASI_Mm02_00350850 predicted 3531
3 SASI_Mm02_00350851 predicted 5538
4 SASI_Mm02_00350852 predicted 4427
5 SASI_Mm02_00350853 predicted 2488
6 SASI_Mm02_00350854 predicted 846
7 SASI_Mm02_00350855 predicted 1385
8 SASI_Mm02_00350856 predicted 4328
9 SASI_Mm02_00350857 predicted 2552
10 SASI_Mm02_00350858 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229477 predicted 2208
2 SASI_Mm01_00229478 predicted 2889
3 SASI_Mm01_00229479 predicted 887
4 SASI_Mm01_00229480 predicted 3096
5 SASI_Mm01_00229481 predicted 979
6 SASI_Mm01_00229482 predicted 1519
7 SASI_Mm01_00229483 predicted 1151
8 SASI_Mm01_00229484 predicted 860
9 SASI_Mm01_00229485 predicted 1629
10 SASI_Mm01_00229486 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198111
AKAP6 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 6
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-4874s21c1
Sequence:CCGGAGTTGGTTGACATCCTATAAGCTCGAGCTTATAGGATGTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198111.2-7367s21c1
Sequence:CCGGCCAAATTGATGGTCCATTAAACTCGAGTTTAATGGACCATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-423s21c1
Sequence:CCGGAGGATATTTGCGAGGATATTTCTCGAGAAATATCCTCGCAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198111
AKAP6 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 6
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-4874s21c1
Sequence:CCGGAGTTGGTTGACATCCTATAAGCTCGAGCTTATAGGATGTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198111.2-7367s21c1
Sequence:CCGGCCAAATTGATGGTCCATTAAACTCGAGTTTAATGGACCATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-423s21c1
Sequence:CCGGAGGATATTTGCGAGGATATTTCTCGAGAAATATCCTCGCAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198111
AKAP6 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 6
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-4874s21c1
Sequence:CCGGAGTTGGTTGACATCCTATAAGCTCGAGCTTATAGGATGTCAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198111.2-7367s21c1
Sequence:CCGGCCAAATTGATGGTCCATTAAACTCGAGTTTAATGGACCATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198111.2-423s21c1
Sequence:CCGGAGGATATTTGCGAGGATATTTCTCGAGAAATATCCTCGCAAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004274
VALIDATED
AKAP6 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1359s21c1
Sequence:GTACCGGGAGGCAAATGGTTGATCTAAACTCGAGTTTAGATCAACCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004274.3-7449s21c1
Sequence:GTACCGGACCAACTGGTAGTCCATTAAACTCGAGTTTAATGGACTACCAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3792s21c1
Sequence:CCGGGGACATAAGTAACAAGTTAATCTCGAGATTAACTTGTTACTTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3495s21c1
Sequence:CCGGTAAGTCCCTCTGTCGTGAAATCTCGAGATTTCACGACAGAGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1577s21c1
Sequence:CCGGGGCTTAACGACTGCTATAAAGCTCGAGCTTTATAGCAGTCGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-3736s1c1
Sequence:CCGGCCTGGCTTGATGGACCTAAATCTCGAGATTTAGGTCCATCAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-5180s1c1
Sequence:CCGGCGGCATCTCTAACAGAACTTACTCGAGTAAGTTCTGTTAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-6279s1c1
Sequence:CCGGCGAAGATTGTTCAGTACACAACTCGAGTTGTGTACTGAACAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-2554s1c1
Sequence:CCGGGCAGAGATGGATGACCTTAAACTCGAGTTTAAGGTCATCCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004274.3-1241s1c1
Sequence:CCGGCCATCAGAGATTGCTTTAATTCTCGAGAATTAAAGCAATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004274
VALIDATED
AKAP6 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1359s21c1
Sequence:GTACCGGGAGGCAAATGGTTGATCTAAACTCGAGTTTAGATCAACCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004274.3-7449s21c1
Sequence:GTACCGGACCAACTGGTAGTCCATTAAACTCGAGTTTAATGGACTACCAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3792s21c1
Sequence:CCGGGGACATAAGTAACAAGTTAATCTCGAGATTAACTTGTTACTTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3495s21c1
Sequence:CCGGTAAGTCCCTCTGTCGTGAAATCTCGAGATTTCACGACAGAGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1577s21c1
Sequence:CCGGGGCTTAACGACTGCTATAAAGCTCGAGCTTTATAGCAGTCGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-3736s1c1
Sequence:CCGGCCTGGCTTGATGGACCTAAATCTCGAGATTTAGGTCCATCAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-5180s1c1
Sequence:CCGGCGGCATCTCTAACAGAACTTACTCGAGTAAGTTCTGTTAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-6279s1c1
Sequence:CCGGCGAAGATTGTTCAGTACACAACTCGAGTTGTGTACTGAACAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-2554s1c1
Sequence:CCGGGCAGAGATGGATGACCTTAAACTCGAGTTTAAGGTCATCCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004274.3-1241s1c1
Sequence:CCGGCCATCAGAGATTGCTTTAATTCTCGAGAATTAAAGCAATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004274
VALIDATED
AKAP6 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1359s21c1
Sequence:GTACCGGGAGGCAAATGGTTGATCTAAACTCGAGTTTAGATCAACCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004274.3-7449s21c1
Sequence:GTACCGGACCAACTGGTAGTCCATTAAACTCGAGTTTAATGGACTACCAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3792s21c1
Sequence:CCGGGGACATAAGTAACAAGTTAATCTCGAGATTAACTTGTTACTTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-3495s21c1
Sequence:CCGGTAAGTCCCTCTGTCGTGAAATCTCGAGATTTCACGACAGAGGGACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004274.3-1577s21c1
Sequence:CCGGGGCTTAACGACTGCTATAAAGCTCGAGCTTTATAGCAGTCGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-3736s1c1
Sequence:CCGGCCTGGCTTGATGGACCTAAATCTCGAGATTTAGGTCCATCAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-5180s1c1
Sequence:CCGGCGGCATCTCTAACAGAACTTACTCGAGTAAGTTCTGTTAGAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-6279s1c1
Sequence:CCGGCGAAGATTGTTCAGTACACAACTCGAGTTGTGTACTGAACAATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004274.3-2554s1c1
Sequence:CCGGGCAGAGATGGATGACCTTAAACTCGAGTTTAAGGTCATCCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004274.3-1241s1c1
Sequence:CCGGCCATCAGAGATTGCTTTAATTCTCGAGAATTAAAGCAATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484140
AKAP6 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1877s1c1
Sequence:CCGGCCTCAAACAAACGGAGGTGTTCTCGAGAACACCTCCGTTTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1058s1c1
Sequence:CCGGGCCTGGTCCTTGTGAAATGATCTCGAGATCATTTCACAAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484140.2-4001s1c1
Sequence:CCGGCCCTTGATTTGATTGTAGTATCTCGAGATACTACAATCAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3049s1c1
Sequence:CCGGGCCTTTCACTACCAAATGATACTCGAGTATCATTTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3311s1c1
Sequence:CCGGCGCCGAGAAACAACTCCAATACTCGAGTATTGGAGTTGTTTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484140
AKAP6 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1877s1c1
Sequence:CCGGCCTCAAACAAACGGAGGTGTTCTCGAGAACACCTCCGTTTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1058s1c1
Sequence:CCGGGCCTGGTCCTTGTGAAATGATCTCGAGATCATTTCACAAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484140.2-4001s1c1
Sequence:CCGGCCCTTGATTTGATTGTAGTATCTCGAGATACTACAATCAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3049s1c1
Sequence:CCGGGCCTTTCACTACCAAATGATACTCGAGTATCATTTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3311s1c1
Sequence:CCGGCGCCGAGAAACAACTCCAATACTCGAGTATTGGAGTTGTTTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484140
AKAP6 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1877s1c1
Sequence:CCGGCCTCAAACAAACGGAGGTGTTCTCGAGAACACCTCCGTTTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-1058s1c1
Sequence:CCGGGCCTGGTCCTTGTGAAATGATCTCGAGATCATTTCACAAGGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484140.2-4001s1c1
Sequence:CCGGCCCTTGATTTGATTGTAGTATCTCGAGATACTACAATCAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3049s1c1
Sequence:CCGGGCCTTTCACTACCAAATGATACTCGAGTATCATTTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484140.2-3311s1c1
Sequence:CCGGCGCCGAGAAACAACTCCAATACTCGAGTATTGGAGTTGTTTCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks