EMAIL THIS PAGE TO A FRIEND

AKAP7

A kinase (PRKA) anchor protein 7

Synonyms: AKAP15 AKAP18
UniProtKB ID: O43687, A8K2K6, Q5TBR9, Q5TBS0, Q9HCZ8, Q9P0G4
Gene ID:
Human(9465) Summary: This gene encodes a member of the A-kinase anchoring protein (AKAP) family, a group of functionally related proteins that bind to a regulatory subunit (RII) of cAMP-dependent protein kinase A (PKA) and target the enzyme to specific subcellular compartments. AKAPs have a common RII-binding domain, but contain different targeting motifs responsible for directing PKA to distinct intracellular locations. Three alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Apr 2011]
Mouse(432442) A kinase (PRKA) anchor protein 7
Rat(361458) A kinase (PRKA) anchor protein 7
Zebrafish(100034399) A kinase (PRKA) anchor protein 7
chicken(426926) A kinase (PRKA) anchor protein 7
dog(484128) A kinase (PRKA) anchor protein 7
cow(613606) A kinase (PRKA) anchor protein 7
domestic cat(101089442) A kinase (PRKA) anchor protein 7
sheep(101121177) A kinase (PRKA) anchor protein 7
domestic guinea pig(101788563) A kinase (PRKA) anchor protein 7
210 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36331 Anti-AKAP7 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, horse, human, mouse, bovine, canine, rabbit
western blot pricing
AV36332 Anti-AKAP7 (AB2) antibody produced in rabbit IgG fraction of antiserum rat, human, horse, rabbit, bovine, canine, mouse
western blot pricing
SAB2108332 Anti-AKAP7 antibody produced in rabbit affinity isolated antibody human, guinea pig, mouse, canine, rabbit, rat, bovine
western blot pricing
AV36333 Anti-AKAP7 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA027172 Anti-AKAP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA028327 Anti-AKAP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103076 Anti-AKAP7 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, human
western blot pricing
WH0009465M1 Monoclonal Anti-AKAP7 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404722 Monoclonal Anti-AKAP7 antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004842 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004842 Rosetta Predictions human pricing
NM_016377 Rosetta Predictions human pricing
NM_138633 Rosetta Predictions human pricing
NM_001001801 Rosetta Predictions rat pricing
XM_001053676 Rosetta Predictions rat pricing
XM_579066 Rosetta Predictions rat pricing
NM_018747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197490 predicted 756
2 SASI_Hs01_00197491 predicted 717
3 SASI_Hs01_00197492 predicted 509
4 SASI_Hs01_00197493 predicted 559
5 SASI_Hs01_00197495 predicted 769
6 SASI_Hs01_00197497 predicted 833
7 SASI_Hs01_00197499 predicted 712
8 SASI_Hs02_00338423 predicted 799
9 SASI_Hs02_00338424 predicted 840
10 SASI_Hs02_00338425 predicted 709
11 SASI_Hs01_00197494 predicted 533
12 SASI_Hs01_00197496 predicted 487
13 SASI_Hs01_00197498 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239842 predicted 1290
2 SASI_Hs01_00239843 predicted 1259
3 SASI_Hs01_00239844 predicted 1052
4 SASI_Hs01_00239845 predicted 1096
5 SASI_Hs01_00239847 predicted 1315
6 SASI_Hs01_00239849 predicted 1375
7 SASI_Hs01_00239851 predicted 1257
8 SASI_Hs02_00349370 predicted 1347
9 SASI_Hs02_00349371 predicted 1388
10 SASI_Hs02_00349372 predicted 1245
11 SASI_Hs01_00239846 predicted 1073
12 SASI_Hs01_00239848 predicted 1034
13 SASI_Hs01_00239850 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060889 predicted 819
2 SASI_Hs01_00060890 predicted 792
3 SASI_Hs01_00060891 predicted 584
4 SASI_Hs01_00060892 predicted 622
5 SASI_Hs01_00060894 predicted 845
6 SASI_Hs01_00060896 predicted 901
7 SASI_Hs01_00060898 predicted 776
8 SASI_Hs02_00363762 predicted 877
9 SASI_Hs02_00363763 predicted 911
10 SASI_Hs02_00363764 predicted 773
11 SASI_Hs01_00060893 predicted 598
12 SASI_Hs01_00060895 predicted 565
13 SASI_Hs01_00060897 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113971 predicted 346
2 SASI_Rn01_00113972 predicted 730
3 SASI_Rn01_00113973 predicted 773
4 SASI_Rn01_00113975 predicted 786
5 SASI_Rn01_00113976 predicted 419
6 SASI_Rn02_00197947 predicted 742
7 SASI_Rn01_00113978 predicted 585
8 SASI_Rn01_00113979 predicted 728
9 SASI_Rn01_00113980 predicted 392
10 SASI_Rn02_00197948 predicted 311
11 SASI_Rn01_00113974 predicted 1261
12 SASI_Rn01_00113977 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273130 predicted 251
2 SASI_Rn02_00273131 predicted 196
3 SASI_Rn02_00273132 predicted 592
4 SASI_Rn02_00273133 predicted 624
5 SASI_Rn02_00273134 predicted 643
6 SASI_Rn02_00273135 predicted 273
7 SASI_Rn02_00273136 predicted 595
8 SASI_Rn02_00273137 predicted 438
9 SASI_Rn02_00273138 predicted 235
10 SASI_Rn02_00273139 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174909 predicted 409
2 SASI_Rn01_00174910 predicted 738
3 SASI_Rn01_00174911 predicted 773
4 SASI_Rn01_00174912 predicted 798
5 SASI_Rn01_00174913 predicted 422
6 SASI_Rn01_00174914 predicted 753
7 SASI_Rn01_00174915 predicted 591
8 SASI_Rn01_00174916 predicted 392
9 SASI_Rn01_00174917 predicted 736
10 SASI_Rn01_00174918 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324008 predicted 412
2 SASI_Mm02_00324009 predicted 1241
3 SASI_Mm02_00324010 predicted 397
4 SASI_Mm02_00324011 predicted 1056
5 SASI_Mm02_00324012 predicted 303
6 SASI_Mm02_00324013 predicted 1151
7 SASI_Mm02_00324014 predicted 497
8 SASI_Mm02_00324015 predicted 826
9 SASI_Mm02_00324016 predicted 869
10 SASI_Mm02_00324017 predicted 849
11 SASI_Mm01_00096541 predicted 1534
12 SASI_Mm01_00096542 predicted 1617
13 SASI_Mm01_00096543 predicted 1536
14 SASI_Mm01_00096544 predicted 953
15 SASI_Mm01_00096545 predicted 780
16 SASI_Mm01_00096546 predicted 567
17 SASI_Mm01_00096547 predicted 785
18 SASI_Mm01_00096548 predicted 705
19 SASI_Mm01_00096549 predicted 635
20 SASI_Mm01_00096550 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018747
AKAP7 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 7
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-490s1c1
Sequence:CCGGCGGCTCCTTTCATATTACCTTCTCGAGAAGGTAATATGAAAGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-420s1c1
Sequence:CCGGCCGGAATTAAATCTTTGCAAACTCGAGTTTGCAAAGATTTAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-842s1c1
Sequence:CCGGCCTGGATTGTATGAACAATTTCTCGAGAAATTGTTCATACAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-884s1c1
Sequence:CCGGGAACTATTGTACCAGATAGATCTCGAGATCTATCTGGTACAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-781s1c1
Sequence:CCGGGACCTTTATGAAGCTGTCCAACTCGAGTTGGACAGCTTCATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018747.3-374s1c1
Sequence:CCGGCCCAACTATTTCCTGTCCATTCTCGAGAATGGACAGGAAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018747
AKAP7 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 7
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-490s1c1
Sequence:CCGGCGGCTCCTTTCATATTACCTTCTCGAGAAGGTAATATGAAAGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-420s1c1
Sequence:CCGGCCGGAATTAAATCTTTGCAAACTCGAGTTTGCAAAGATTTAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-842s1c1
Sequence:CCGGCCTGGATTGTATGAACAATTTCTCGAGAAATTGTTCATACAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-884s1c1
Sequence:CCGGGAACTATTGTACCAGATAGATCTCGAGATCTATCTGGTACAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-781s1c1
Sequence:CCGGGACCTTTATGAAGCTGTCCAACTCGAGTTGGACAGCTTCATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018747.3-374s1c1
Sequence:CCGGCCCAACTATTTCCTGTCCATTCTCGAGAATGGACAGGAAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018747
AKAP7 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 7
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-490s1c1
Sequence:CCGGCGGCTCCTTTCATATTACCTTCTCGAGAAGGTAATATGAAAGGAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-420s1c1
Sequence:CCGGCCGGAATTAAATCTTTGCAAACTCGAGTTTGCAAAGATTTAATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-842s1c1
Sequence:CCGGCCTGGATTGTATGAACAATTTCTCGAGAAATTGTTCATACAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-884s1c1
Sequence:CCGGGAACTATTGTACCAGATAGATCTCGAGATCTATCTGGTACAATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018747.3-781s1c1
Sequence:CCGGGACCTTTATGAAGCTGTCCAACTCGAGTTGGACAGCTTCATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018747.3-374s1c1
Sequence:CCGGCCCAACTATTTCCTGTCCATTCTCGAGAATGGACAGGAAATAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004842
VALIDATED
AKAP7 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-406s1c1
Sequence:CCGGGCAGCTGATCAGAATGGCAATCTCGAGATTGCCATTCTGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-349s1c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-275s1c1
Sequence:CCGGCCGATGACGCTGAACTAGTAACTCGAGTTACTAGTTCAGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-284s1c1
Sequence:CCGGCTGAACTAGTAAGGCTCAGTACTCGAGTACTGAGCCTTACTAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-427s1c1
Sequence:CCGGGACAATGAGAACAACAGGAAACTCGAGTTTCCTGTTGTTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-300s21c1
Sequence:CCGGCAGTAAGAGGCTGGTGGAGAACTCGAGTTCTCCACCAGCCTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-423s21c1
Sequence:CCGGCAATGACAATGAGAACAACAGCTCGAGCTGTTGTTCTCATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004842.2-729s21c1
Sequence:CCGGATGCCTCCTGGACGCAAATTACTCGAGTAATTTGCGTCCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-401s21c1
Sequence:CCGGCCGAAGCAGCTGATCAGAATGCTCGAGCATTCTGATCAGCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-349s21c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004842
VALIDATED
AKAP7 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-406s1c1
Sequence:CCGGGCAGCTGATCAGAATGGCAATCTCGAGATTGCCATTCTGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-349s1c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-275s1c1
Sequence:CCGGCCGATGACGCTGAACTAGTAACTCGAGTTACTAGTTCAGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-284s1c1
Sequence:CCGGCTGAACTAGTAAGGCTCAGTACTCGAGTACTGAGCCTTACTAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-427s1c1
Sequence:CCGGGACAATGAGAACAACAGGAAACTCGAGTTTCCTGTTGTTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-300s21c1
Sequence:CCGGCAGTAAGAGGCTGGTGGAGAACTCGAGTTCTCCACCAGCCTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-423s21c1
Sequence:CCGGCAATGACAATGAGAACAACAGCTCGAGCTGTTGTTCTCATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004842.2-729s21c1
Sequence:CCGGATGCCTCCTGGACGCAAATTACTCGAGTAATTTGCGTCCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-401s21c1
Sequence:CCGGCCGAAGCAGCTGATCAGAATGCTCGAGCATTCTGATCAGCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-349s21c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004842
VALIDATED
AKAP7 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-406s1c1
Sequence:CCGGGCAGCTGATCAGAATGGCAATCTCGAGATTGCCATTCTGATCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-349s1c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-275s1c1
Sequence:CCGGCCGATGACGCTGAACTAGTAACTCGAGTTACTAGTTCAGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004842.2-284s1c1
Sequence:CCGGCTGAACTAGTAAGGCTCAGTACTCGAGTACTGAGCCTTACTAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004842.2-427s1c1
Sequence:CCGGGACAATGAGAACAACAGGAAACTCGAGTTTCCTGTTGTTCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-300s21c1
Sequence:CCGGCAGTAAGAGGCTGGTGGAGAACTCGAGTTCTCCACCAGCCTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-423s21c1
Sequence:CCGGCAATGACAATGAGAACAACAGCTCGAGCTGTTGTTCTCATTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004842.2-729s21c1
Sequence:CCGGATGCCTCCTGGACGCAAATTACTCGAGTAATTTGCGTCCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-401s21c1
Sequence:CCGGCCGAAGCAGCTGATCAGAATGCTCGAGCATTCTGATCAGCTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004842.2-349s21c1
Sequence:CCGGCTGGAGGAAACACAGAATAAACTCGAGTTTATTCTGTGTTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks