EMAIL THIS PAGE TO A FRIEND

AKAP8

A kinase (PRKA) anchor protein 8

Synonyms: AKAP 95 AKAP-8 AKAP-95 AKAP95
UniProtKB ID: O43823
Gene ID:
Human(10270) Summary: This gene encodes a member of the A-kinase anchor protein family. A-kinase anchor proteins are scaffold proteins that contain a binding domain for the RI/RII subunit of protein kinase A (PKA) and recruit PKA and other signaling molecules to specific subcellular locations. This gene encodes a nuclear A-kinase anchor protein that binds to the RII alpha subunit of PKA and may play a role in chromosome condensation during mitosis by targeting PKA and the condensin complex to chromatin. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
Mouse(56399) A kinase (PRKA) anchor protein 8
Rat(116633) A kinase (PRKA) anchor protein 8
naked mole-rat(101723482) A kinase (PRKA) anchor protein 8
domestic guinea pig(100732334) A kinase (PRKA) anchor protein 8
sheep(101119815) A kinase (PRKA) anchor protein 8
Domestic Rabbit(100349200) A kinase (PRKA) anchor protein 8
chicken(426167) A kinase (PRKA) anchor protein 8
dog(474362) A kinase (PRKA) anchor protein 8
domestic cat(101090241) A kinase (PRKA) anchor protein 8
cow(522905) A kinase (PRKA) anchor protein 8
Horse(100063189) A kinase (PRKA) anchor protein 8
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005858 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138441 MISSION® esiRNA esiRNA human AKAP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005858 Rosetta Predictions human pricing
NM_053855 Rosetta Predictions rat pricing
NM_019774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229348 predicted 1778
2 SASI_Hs01_00229349 predicted 1615
3 SASI_Hs01_00229350 predicted 1788
4 SASI_Hs01_00229351 predicted 1695
5 SASI_Hs01_00229352 predicted 308
6 SASI_Hs01_00229353 predicted 559
7 SASI_Hs01_00229354 predicted 298
8 SASI_Hs01_00229355 predicted 1737
9 SASI_Hs01_00229356 predicted 1435
10 SASI_Hs02_00340409 predicted 346
11 SASI_Hs01_00229357 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266710 predicted 471
2 SASI_Rn02_00266711 predicted 316
3 SASI_Rn02_00266712 predicted 1659
4 SASI_Rn02_00266713 predicted 1579
5 SASI_Rn02_00266714 predicted 1393
6 SASI_Rn02_00266715 predicted 1684
7 SASI_Rn02_00266716 predicted 1899
8 SASI_Rn02_00266717 predicted 240
9 SASI_Rn02_00266718 predicted 1383
10 SASI_Rn02_00266719 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192162 predicted 495
2 SASI_Mm01_00192163 predicted 462
3 SASI_Mm01_00192164 predicted 1339
4 SASI_Mm01_00192165 predicted 2094
5 SASI_Mm02_00324974 predicted 957
6 SASI_Mm01_00192166 predicted 1676
7 SASI_Mm01_00192167 predicted 1414
8 SASI_Mm01_00192168 predicted 2168
9 SASI_Mm01_00192169 predicted 2120
10 SASI_Mm01_00192171 predicted 710
11 SASI_Mm01_00192170 predicted 1924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019774
VALIDATED
AKAP8 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 8
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1337s21c1
Sequence:CCGGCCTCCAGGAGTACATCATAAACTCGAGTTTATGATGTACTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-463s21c1
Sequence:CCGGCCTGTATACCTGAGCATAATCCTCGAGGATTATGCTCAGGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-96s21c1
Sequence:CCGGGCCAACACCCAGGGTACATATCTCGAGATATGTACCCTGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2354s21c1
Sequence:CCGGAGTAGATCTTCCTGGTAATTGCTCGAGCAATTACCAGGAAGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-2097s21c1
Sequence:CCGGGATATTCCCACCGAATGATTTCTCGAGAAATCATTCGGTGGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1283s21c1
Sequence:CCGGCAAAGAGACTTTGCGATTTATCTCGAGATAAATCGCAAAGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2330s21c1
Sequence:CCGGGTGCACTGCAGTTAGAATAATCTCGAGATTATTCTAACTGCAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1542s21c1
Sequence:CCGGTCCGTGGACCATAACCATAATCTCGAGATTATGGTTATGGTCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019774.2-3215s1c1
Sequence:CCGGCCTCTATTTGTGCAGGATTATCTCGAGATAATCCTGCACAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019774.2-1213s1c1
Sequence:CCGGGCCTGTTCTGTATGCAAGTTTCTCGAGAAACTTGCATACAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-462s1c1
Sequence:CCGGGCCCTGTATACCTGAGCATAACTCGAGTTATGCTCAGGTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-1317s1c1
Sequence:CCGGGCCCGACAAGACAGTAGAATTCTCGAGAATTCTACTGTCTTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-2093s1c1
Sequence:CCGGCCAAAGATATTCCCACCGAATCTCGAGATTCGGTGGGAATATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019774
VALIDATED
AKAP8 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 8
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1337s21c1
Sequence:CCGGCCTCCAGGAGTACATCATAAACTCGAGTTTATGATGTACTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-463s21c1
Sequence:CCGGCCTGTATACCTGAGCATAATCCTCGAGGATTATGCTCAGGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-96s21c1
Sequence:CCGGGCCAACACCCAGGGTACATATCTCGAGATATGTACCCTGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2354s21c1
Sequence:CCGGAGTAGATCTTCCTGGTAATTGCTCGAGCAATTACCAGGAAGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-2097s21c1
Sequence:CCGGGATATTCCCACCGAATGATTTCTCGAGAAATCATTCGGTGGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1283s21c1
Sequence:CCGGCAAAGAGACTTTGCGATTTATCTCGAGATAAATCGCAAAGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2330s21c1
Sequence:CCGGGTGCACTGCAGTTAGAATAATCTCGAGATTATTCTAACTGCAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1542s21c1
Sequence:CCGGTCCGTGGACCATAACCATAATCTCGAGATTATGGTTATGGTCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019774.2-3215s1c1
Sequence:CCGGCCTCTATTTGTGCAGGATTATCTCGAGATAATCCTGCACAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019774.2-1213s1c1
Sequence:CCGGGCCTGTTCTGTATGCAAGTTTCTCGAGAAACTTGCATACAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-462s1c1
Sequence:CCGGGCCCTGTATACCTGAGCATAACTCGAGTTATGCTCAGGTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-1317s1c1
Sequence:CCGGGCCCGACAAGACAGTAGAATTCTCGAGAATTCTACTGTCTTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-2093s1c1
Sequence:CCGGCCAAAGATATTCCCACCGAATCTCGAGATTCGGTGGGAATATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019774
VALIDATED
AKAP8 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 8
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1337s21c1
Sequence:CCGGCCTCCAGGAGTACATCATAAACTCGAGTTTATGATGTACTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-463s21c1
Sequence:CCGGCCTGTATACCTGAGCATAATCCTCGAGGATTATGCTCAGGTATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-96s21c1
Sequence:CCGGGCCAACACCCAGGGTACATATCTCGAGATATGTACCCTGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2354s21c1
Sequence:CCGGAGTAGATCTTCCTGGTAATTGCTCGAGCAATTACCAGGAAGATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-2097s21c1
Sequence:CCGGGATATTCCCACCGAATGATTTCTCGAGAAATCATTCGGTGGGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1283s21c1
Sequence:CCGGCAAAGAGACTTTGCGATTTATCTCGAGATAAATCGCAAAGTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019774.4-2330s21c1
Sequence:CCGGGTGCACTGCAGTTAGAATAATCTCGAGATTATTCTAACTGCAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019774.4-1542s21c1
Sequence:CCGGTCCGTGGACCATAACCATAATCTCGAGATTATGGTTATGGTCCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019774.2-3215s1c1
Sequence:CCGGCCTCTATTTGTGCAGGATTATCTCGAGATAATCCTGCACAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019774.2-1213s1c1
Sequence:CCGGGCCTGTTCTGTATGCAAGTTTCTCGAGAAACTTGCATACAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-462s1c1
Sequence:CCGGGCCCTGTATACCTGAGCATAACTCGAGTTATGCTCAGGTATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-1317s1c1
Sequence:CCGGGCCCGACAAGACAGTAGAATTCTCGAGAATTCTACTGTCTTGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019774.2-2093s1c1
Sequence:CCGGCCAAAGATATTCCCACCGAATCTCGAGATTCGGTGGGAATATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005858
VALIDATED
AKAP8 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1738s21c1
Sequence:GTACCGGCAATTTAGGAGGTGAGGATAACTCGAGTTATCCTCACCTCCTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005858.2-2867s21c1
Sequence:CCGGATTAGTTACTACCACTCAAATCTCGAGATTTGAGTGGTAGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1788s21c1
Sequence:CCGGACGTCTTAGCAGAGGTGATTACTCGAGTAATCACCTCTGCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-306s21c1
Sequence:CCGGCAGAGCCATGCACCGACAATTCTCGAGAATTGTCGGTGCATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-973s21c1
Sequence:CCGGACGGAAGCAGTTCCAACTTTACTCGAGTAAAGTTGGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-2108s1c1
Sequence:CCGGGCAGAGTCTAAAGACGCTGTTCTCGAGAACAGCGTCTTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1592s1c1
Sequence:CCGGGCTGCTGAACAGTTCAAGAAACTCGAGTTTCTTGAACTGTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005858.2-141s1c1
Sequence:CCGGCCAGCTGGCAAGGTTATGAAACTCGAGTTTCATAACCTTGCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1241s1c1
Sequence:CCGGGTATGCAAGTTCCGTAGCTTTCTCGAGAAAGCTACGGAACTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1357s1c1
Sequence:CCGGCCTCCAGGAATACATTGTAAACTCGAGTTTACAATGTATTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005858
VALIDATED
AKAP8 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1738s21c1
Sequence:GTACCGGCAATTTAGGAGGTGAGGATAACTCGAGTTATCCTCACCTCCTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005858.2-2867s21c1
Sequence:CCGGATTAGTTACTACCACTCAAATCTCGAGATTTGAGTGGTAGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1788s21c1
Sequence:CCGGACGTCTTAGCAGAGGTGATTACTCGAGTAATCACCTCTGCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-306s21c1
Sequence:CCGGCAGAGCCATGCACCGACAATTCTCGAGAATTGTCGGTGCATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-973s21c1
Sequence:CCGGACGGAAGCAGTTCCAACTTTACTCGAGTAAAGTTGGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-2108s1c1
Sequence:CCGGGCAGAGTCTAAAGACGCTGTTCTCGAGAACAGCGTCTTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1592s1c1
Sequence:CCGGGCTGCTGAACAGTTCAAGAAACTCGAGTTTCTTGAACTGTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005858.2-141s1c1
Sequence:CCGGCCAGCTGGCAAGGTTATGAAACTCGAGTTTCATAACCTTGCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1241s1c1
Sequence:CCGGGTATGCAAGTTCCGTAGCTTTCTCGAGAAAGCTACGGAACTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1357s1c1
Sequence:CCGGCCTCCAGGAATACATTGTAAACTCGAGTTTACAATGTATTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005858
VALIDATED
AKAP8 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1738s21c1
Sequence:GTACCGGCAATTTAGGAGGTGAGGATAACTCGAGTTATCCTCACCTCCTAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005858.2-2867s21c1
Sequence:CCGGATTAGTTACTACCACTCAAATCTCGAGATTTGAGTGGTAGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005858.2-1788s21c1
Sequence:CCGGACGTCTTAGCAGAGGTGATTACTCGAGTAATCACCTCTGCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-306s21c1
Sequence:CCGGCAGAGCCATGCACCGACAATTCTCGAGAATTGTCGGTGCATGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005858.2-973s21c1
Sequence:CCGGACGGAAGCAGTTCCAACTTTACTCGAGTAAAGTTGGAACTGCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-2108s1c1
Sequence:CCGGGCAGAGTCTAAAGACGCTGTTCTCGAGAACAGCGTCTTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1592s1c1
Sequence:CCGGGCTGCTGAACAGTTCAAGAAACTCGAGTTTCTTGAACTGTTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005858.2-141s1c1
Sequence:CCGGCCAGCTGGCAAGGTTATGAAACTCGAGTTTCATAACCTTGCCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1241s1c1
Sequence:CCGGGTATGCAAGTTCCGTAGCTTTCTCGAGAAAGCTACGGAACTTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005858.2-1357s1c1
Sequence:CCGGCCTCCAGGAATACATTGTAAACTCGAGTTTACAATGTATTCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks