EMAIL THIS PAGE TO A FRIEND

AKAP8L

A kinase (PRKA) anchor protein 8-like

69 Gene Product Result for
Synonyms: HA95 HAP95 NAKAP NAKAP95
Gene ID:
Mouse(54194) A kinase (PRKA) anchor protein 8-like
Rat(299569) A kinase (PRKA) anchor protein 8-like
Zebrafish(406500) A kinase (PRKA) anchor protein 8-like
dog(612946) A kinase (PRKA) anchor protein 8-like
cow(539700) A kinase (PRKA) anchor protein 8-like
domestic cat(101088728) A kinase (PRKA) anchor protein 8-like
chicken(776856) A kinase (PRKA) anchor protein 8-like
sheep(101119556) A kinase (PRKA) anchor protein 8-like
Domestic Rabbit(100348949) A kinase (PRKA) anchor protein 8-like
domestic guinea pig(100717419) A kinase (PRKA) anchor protein 8-like
naked mole-rat(101724090) A kinase (PRKA) anchor protein 8-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014371 Rosetta Predictions human pricing
NM_001013946 Rosetta Predictions rat pricing
NM_017476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144839 predicted 990
2 SASI_Hs01_00144840 predicted 1339
3 SASI_Hs01_00144841 predicted 404
4 SASI_Hs01_00144842 predicted 379
5 SASI_Hs01_00144843 predicted 1397
6 SASI_Hs01_00144844 predicted 254
7 SASI_Hs01_00144845 predicted 562
8 SASI_Hs01_00144846 predicted 865
9 SASI_Hs01_00144847 predicted 560
10 SASI_Hs01_00144848 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052280 predicted 1595
2 SASI_Rn01_00052281 predicted 1323
3 SASI_Rn01_00052282 predicted 1685
4 SASI_Rn01_00052283 predicted 1470
5 SASI_Rn01_00052284 predicted 471
6 SASI_Rn01_00052285 predicted 1623
7 SASI_Rn01_00052286 predicted 858
8 SASI_Rn01_00052287 predicted 208
9 SASI_Rn01_00052288 predicted 508
10 SASI_Rn01_00052289 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063923 predicted 545
2 SASI_Mm01_00063924 predicted 364
3 SASI_Mm01_00063925 predicted 456
4 SASI_Mm01_00063926 predicted 966
5 SASI_Mm01_00063927 predicted 353
6 SASI_Mm01_00063928 predicted 1020
7 SASI_Mm01_00063929 predicted 505
8 SASI_Mm01_00063930 predicted 199
9 SASI_Mm01_00063931 predicted 349
10 SASI_Mm02_00323943 predicted 540
11 SASI_Mm01_00063922 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017476
VALIDATED
AKAP8L MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 8-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-151s1c1
Sequence:CCGGCCCACCTGTGATTATGGATATCTCGAGATATCCATAATCACAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-107s1c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017476.2-204s1c1
Sequence:CCGGCGAGAACTATGGTTATGGCTACTCGAGTAGCCATAACCATAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-750s1c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-1314s1c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1700s21c1
Sequence:CCGGGATATCTGAAGGGCGAGAATCCTCGAGGATTCTCGCCCTTCAGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-107s21c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1314s21c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-750s21c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-500s21c1
Sequence:CCGGACCGGTCAAGCTATGACTATGCTCGAGCATAGTCATAGCTTGACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017476
VALIDATED
AKAP8L MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 8-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-151s1c1
Sequence:CCGGCCCACCTGTGATTATGGATATCTCGAGATATCCATAATCACAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-107s1c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017476.2-204s1c1
Sequence:CCGGCGAGAACTATGGTTATGGCTACTCGAGTAGCCATAACCATAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-750s1c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-1314s1c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1700s21c1
Sequence:CCGGGATATCTGAAGGGCGAGAATCCTCGAGGATTCTCGCCCTTCAGATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-107s21c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1314s21c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-750s21c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-500s21c1
Sequence:CCGGACCGGTCAAGCTATGACTATGCTCGAGCATAGTCATAGCTTGACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017476
VALIDATED
AKAP8L MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 8-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-151s1c1
Sequence:CCGGCCCACCTGTGATTATGGATATCTCGAGATATCCATAATCACAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-107s1c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017476.2-204s1c1
Sequence:CCGGCGAGAACTATGGTTATGGCTACTCGAGTAGCCATAACCATAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-750s1c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017476.2-1314s1c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1700s21c1
Sequence:CCGGGATATCTGAAGGGCGAGAATCCTCGAGGATTCTCGCCCTTCAGATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-107s21c1
Sequence:CCGGCCGAAACCACTTTGCAGTCTACTCGAGTAGACTGCAAAGTGGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-1314s21c1
Sequence:CCGGCCACAAGGAACACTTCAAATACTCGAGTATTTGAAGTGTTCCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-750s21c1
Sequence:CCGGCCAGAACATCATACCCGAGTACTCGAGTACTCGGGTATGATGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017476.2-500s21c1
Sequence:CCGGACCGGTCAAGCTATGACTATGCTCGAGCATAGTCATAGCTTGACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014371
VALIDATED
AKAP8L MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 8-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1351s1c1
Sequence:CCGGCGTCACTAACAAGACCAAGAACTCGAGTTCTTGGTCTTGTTAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-213s1c1
Sequence:CCGGCCACCAACTATGGGTATGGTACTCGAGTACCATACCCATAGTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-853s1c1
Sequence:CCGGCGACTTCCGAACCAAGAAGAACTCGAGTTCTTCTTGGTTCGGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1624s1c1
Sequence:CCGGCCGCAGTATTCTCAACAACAACTCGAGTTGTTGTTGAGAATACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-123s1c1
Sequence:CCGGCCTGTGATTATGGATATGGAACTCGAGTTCCATATCCATAATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-393s21c1
Sequence:CCGGCTTAGATATGGTGCCGCATTTCTCGAGAAATGCGGCACCATATCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-133s21c1
Sequence:CCGGACCACTTTGCAGTCGACATACCTCGAGGTATGTCGACTGCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-257s21c1
Sequence:CCGGAGGATAACACCACCAACTATGCTCGAGCATAGTTGGTGGTGTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-198s21c1
Sequence:CCGGTTGGAACTCTGGGACAAATAGCTCGAGCTATTTGTCCCAGAGTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-1393s21c1
Sequence:CCGGCTGCAGGAGTACGTCACTAACCTCGAGGTTAGTGACGTACTCCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014371
VALIDATED
AKAP8L MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 8-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1351s1c1
Sequence:CCGGCGTCACTAACAAGACCAAGAACTCGAGTTCTTGGTCTTGTTAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-213s1c1
Sequence:CCGGCCACCAACTATGGGTATGGTACTCGAGTACCATACCCATAGTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-853s1c1
Sequence:CCGGCGACTTCCGAACCAAGAAGAACTCGAGTTCTTCTTGGTTCGGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1624s1c1
Sequence:CCGGCCGCAGTATTCTCAACAACAACTCGAGTTGTTGTTGAGAATACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-123s1c1
Sequence:CCGGCCTGTGATTATGGATATGGAACTCGAGTTCCATATCCATAATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-393s21c1
Sequence:CCGGCTTAGATATGGTGCCGCATTTCTCGAGAAATGCGGCACCATATCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-133s21c1
Sequence:CCGGACCACTTTGCAGTCGACATACCTCGAGGTATGTCGACTGCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-257s21c1
Sequence:CCGGAGGATAACACCACCAACTATGCTCGAGCATAGTTGGTGGTGTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-198s21c1
Sequence:CCGGTTGGAACTCTGGGACAAATAGCTCGAGCTATTTGTCCCAGAGTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-1393s21c1
Sequence:CCGGCTGCAGGAGTACGTCACTAACCTCGAGGTTAGTGACGTACTCCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014371
VALIDATED
AKAP8L MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 8-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1351s1c1
Sequence:CCGGCGTCACTAACAAGACCAAGAACTCGAGTTCTTGGTCTTGTTAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-213s1c1
Sequence:CCGGCCACCAACTATGGGTATGGTACTCGAGTACCATACCCATAGTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-853s1c1
Sequence:CCGGCGACTTCCGAACCAAGAAGAACTCGAGTTCTTCTTGGTTCGGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-1624s1c1
Sequence:CCGGCCGCAGTATTCTCAACAACAACTCGAGTTGTTGTTGAGAATACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014371.1-123s1c1
Sequence:CCGGCCTGTGATTATGGATATGGAACTCGAGTTCCATATCCATAATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-393s21c1
Sequence:CCGGCTTAGATATGGTGCCGCATTTCTCGAGAAATGCGGCACCATATCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-133s21c1
Sequence:CCGGACCACTTTGCAGTCGACATACCTCGAGGTATGTCGACTGCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-257s21c1
Sequence:CCGGAGGATAACACCACCAACTATGCTCGAGCATAGTTGGTGGTGTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014371.2-198s21c1
Sequence:CCGGTTGGAACTCTGGGACAAATAGCTCGAGCTATTTGTCCCAGAGTTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014371.2-1393s21c1
Sequence:CCGGCTGCAGGAGTACGTCACTAACCTCGAGGTTAGTGACGTACTCCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)