EMAIL THIS PAGE TO A FRIEND

AKAP9

A kinase (PRKA) anchor protein (yotiao) 9

169 Gene Product Result for
Synonyms: AKAP-9 AKAP350 AKAP450 CG-NAP HYPERION LQT11 MU-RMS-40.16A PPP1R45 PRKA9 YOTIAO
Gene ID:
Human(10142) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternate splicing of this gene results in at least two isoforms that localize to the centrosome and the Golgi apparatus, and interact with numerous signaling proteins from multiple signal transduction pathways. These signaling proteins include type II protein kinase A, serine/threonine kinase protein kinase N, protein phosphatase 1, protein phosphatase 2a, protein kinase C-epsilon and phosphodiesterase 4D3. [provided by RefSeq, Aug 2008]
Mouse(100986) A kinase (PRKA) anchor protein (yotiao) 9
Rat(246150) A kinase (PRKA) anchor protein (yotiao) 9
naked mole-rat(101723786) A kinase (PRKA) anchor protein (yotiao) 9
domestic guinea pig(100716666) A kinase (PRKA) anchor protein (yotiao) 9
sheep(101109958) A kinase (PRKA) anchor protein (yotiao) 9
sheep(100500721) A kinase (PRKA) anchor protein (yotiao) 9
Zebrafish(565037) A kinase (PRKA) anchor protein (yotiao) 9
cow(767893) A kinase (PRKA) anchor protein (yotiao) 9
Horse(100061002) A kinase (PRKA) anchor protein (yotiao) 9
domestic cat(101085536) A kinase (PRKA) anchor protein (yotiao) 9
dog(475224) A kinase (PRKA) anchor protein (yotiao) 9
chicken(395695) A kinase (PRKA) anchor protein (yotiao) 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005751 Rosetta Predictions human pricing
NM_147166 Rosetta Predictions human pricing
NM_147171 Rosetta Predictions human pricing
NM_147185 Rosetta Predictions human pricing
NM_001037093 Rosetta Predictions rat pricing
XM_575357 Rosetta Predictions rat pricing
NM_194462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340212 predicted 3750
2 SASI_Hs02_00340213 predicted 3758
3 SASI_Hs02_00340214 predicted 1722
4 SASI_Hs01_00090011 predicted 3551
5 SASI_Hs01_00090012 predicted 2606
6 SASI_Hs01_00090014 predicted 1896
7 SASI_Hs01_00090015 predicted 605
8 SASI_Hs02_00340215 predicted 1629
9 SASI_Hs02_00340216 predicted 3461
10 SASI_Hs02_00340217 predicted 2713
11 SASI_Hs01_00090010 predicted 3128
12 SASI_Hs01_00090013 predicted 2158
13 SASI_Hs01_00090016 predicted 2712
14 SASI_Hs01_00090017 predicted 4597
15 SASI_Hs01_00090018 predicted 622
16 SASI_Hs01_00090019 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365498 predicted 3787
2 SASI_Hs02_00365499 predicted 3801
3 SASI_Hs02_00365500 predicted 1756
4 SASI_Hs02_00365501 predicted 833
5 SASI_Hs01_00222587 predicted 3586
6 SASI_Hs01_00222588 predicted 2644
7 SASI_Hs01_00222590 predicted 1934
8 SASI_Hs01_00222591 predicted 643
9 SASI_Hs01_00222593 predicted 4623
10 SASI_Hs02_00365502 predicted 3497
11 SASI_Hs01_00222586 predicted 3159
12 SASI_Hs01_00222589 predicted 2188
13 SASI_Hs01_00222592 predicted 2754
14 SASI_Hs01_00222594 predicted 660
15 SASI_Hs01_00222595 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365505 predicted 3783
2 SASI_Hs02_00365506 predicted 3798
3 SASI_Hs02_00365507 predicted 1758
4 SASI_Hs01_00113208 predicted 3591
5 SASI_Hs01_00113209 predicted 2648
6 SASI_Hs01_00113211 predicted 1931
7 SASI_Hs01_00113212 predicted 637
8 SASI_Hs02_00365508 predicted 1665
9 SASI_Hs02_00365509 predicted 3496
10 SASI_Hs02_00365510 predicted 2752
11 SASI_Hs01_00113207 predicted 3157
12 SASI_Hs01_00113210 predicted 2193
13 SASI_Hs01_00113213 predicted 2747
14 SASI_Hs01_00113214 predicted 4626
15 SASI_Hs01_00113215 predicted 667
16 SASI_Hs01_00113216 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365521 predicted 3750
2 SASI_Hs02_00365522 predicted 3765
3 SASI_Hs02_00365523 predicted 1719
4 SASI_Hs01_00050245 predicted 3555
5 SASI_Hs01_00050246 predicted 2607
6 SASI_Hs01_00050248 predicted 1898
7 SASI_Hs01_00050249 predicted 601
8 SASI_Hs02_00365524 predicted 1634
9 SASI_Hs02_00365525 predicted 3452
10 SASI_Hs02_00365526 predicted 2717
11 SASI_Hs01_00050244 predicted 3125
12 SASI_Hs01_00050247 predicted 2157
13 SASI_Hs01_00050250 predicted 2716
14 SASI_Hs01_00050251 predicted 4598
15 SASI_Hs01_00050252 predicted 631
16 SASI_Hs01_00050253 predicted 2041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204215 predicted 540
2 SASI_Rn02_00204216 predicted 1009
3 SASI_Rn02_00204217 predicted 1069
4 SASI_Rn02_00204218 predicted 2704
5 SASI_Rn02_00204219 predicted 1315
6 SASI_Rn02_00204220 predicted 2661
7 SASI_Rn02_00204221 predicted 3519
8 SASI_Rn02_00204222 predicted 1086
9 SASI_Rn02_00204223 predicted 2836
10 SASI_Rn02_00204224 predicted 2487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146451 predicted 2506
2 SASI_Rn01_00146452 predicted 3687
3 SASI_Rn01_00146453 predicted 3350
4 SASI_Rn01_00146454 predicted 418
5 SASI_Rn01_00146455 predicted 2220
6 SASI_Rn01_00146456 predicted 591
7 SASI_Rn01_00146457 predicted 385
8 SASI_Rn01_00146458 predicted 2971
9 SASI_Rn01_00146459 predicted 3631
10 SASI_Rn01_00146460 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350637 predicted 3713
2 SASI_Mm02_00350638 predicted 8097
3 SASI_Mm02_00350639 predicted 3847
4 SASI_Mm02_00350640 predicted 10644
5 SASI_Mm02_00350641 predicted 737
6 SASI_Mm02_00350642 predicted 5232
7 SASI_Mm02_00350643 predicted 11496
8 SASI_Mm02_00350644 predicted 4432
9 SASI_Mm02_00350645 predicted 11684
10 SASI_Mm02_00350646 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194462
VALIDATED
AKAP9 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein (yotiao) 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11687s21c1
Sequence:CCGGACCAATACATGCACAGCTTATCTCGAGATAAGCTGTGCATGTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11780s21c1
Sequence:CCGGGTTCATGCACAGTAATCATTACTCGAGTAATGATTACTGTGCATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-2072s21c1
Sequence:CCGGAGAAGTAGAACATCGAATAAACTCGAGTTTATTCGATGTTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-5165s21c1
Sequence:CCGGAGTTGAGGAACAGACGTTAAACTCGAGTTTAACGTCTGTTCCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-929s21c1
Sequence:CCGGCAGCCGAACTGCGACAGATTTCTCGAGAAATCTGTCGCAGTTCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4860s21c1
Sequence:CCGGCAAGAACTTGTGCGACAATATCTCGAGATATTGTCGCACAAGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4639s21c1
Sequence:CCGGGCAAAGAGTTAGGCGAATATACTCGAGTATATTCGCCTAACTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-744s21c1
Sequence:CCGGGAATTTGAAGCCGCCATTAAACTCGAGTTTAATGGCGGCTTCAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-11623s1c1
Sequence:CCGGGCAGCAGCACATGAAGACAAACTCGAGTTTGTCTTCATGTGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6865s1c1
Sequence:CCGGCGGTTAAATGAGCAGTTTATACTCGAGTATAAACTGCTCATTTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6864s1c1
Sequence:CCGGCCGGTTAAATGAGCAGTTTATCTCGAGATAAACTGCTCATTTAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-9842s1c1
Sequence:CCGGGCCGCATAGTAGAACTGTTAACTCGAGTTAACAGTTCTACTATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-3701s1c1
Sequence:CCGGGCCCAGAATTACAAGAGTATACTCGAGTATACTCTTGTAATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194462
VALIDATED
AKAP9 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein (yotiao) 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11687s21c1
Sequence:CCGGACCAATACATGCACAGCTTATCTCGAGATAAGCTGTGCATGTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11780s21c1
Sequence:CCGGGTTCATGCACAGTAATCATTACTCGAGTAATGATTACTGTGCATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-2072s21c1
Sequence:CCGGAGAAGTAGAACATCGAATAAACTCGAGTTTATTCGATGTTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-5165s21c1
Sequence:CCGGAGTTGAGGAACAGACGTTAAACTCGAGTTTAACGTCTGTTCCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-929s21c1
Sequence:CCGGCAGCCGAACTGCGACAGATTTCTCGAGAAATCTGTCGCAGTTCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4860s21c1
Sequence:CCGGCAAGAACTTGTGCGACAATATCTCGAGATATTGTCGCACAAGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4639s21c1
Sequence:CCGGGCAAAGAGTTAGGCGAATATACTCGAGTATATTCGCCTAACTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-744s21c1
Sequence:CCGGGAATTTGAAGCCGCCATTAAACTCGAGTTTAATGGCGGCTTCAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-11623s1c1
Sequence:CCGGGCAGCAGCACATGAAGACAAACTCGAGTTTGTCTTCATGTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6865s1c1
Sequence:CCGGCGGTTAAATGAGCAGTTTATACTCGAGTATAAACTGCTCATTTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6864s1c1
Sequence:CCGGCCGGTTAAATGAGCAGTTTATCTCGAGATAAACTGCTCATTTAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-9842s1c1
Sequence:CCGGGCCGCATAGTAGAACTGTTAACTCGAGTTAACAGTTCTACTATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-3701s1c1
Sequence:CCGGGCCCAGAATTACAAGAGTATACTCGAGTATACTCTTGTAATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194462
VALIDATED
AKAP9 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein (yotiao) 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11687s21c1
Sequence:CCGGACCAATACATGCACAGCTTATCTCGAGATAAGCTGTGCATGTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194462.2-11780s21c1
Sequence:CCGGGTTCATGCACAGTAATCATTACTCGAGTAATGATTACTGTGCATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-2072s21c1
Sequence:CCGGAGAAGTAGAACATCGAATAAACTCGAGTTTATTCGATGTTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-5165s21c1
Sequence:CCGGAGTTGAGGAACAGACGTTAAACTCGAGTTTAACGTCTGTTCCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-929s21c1
Sequence:CCGGCAGCCGAACTGCGACAGATTTCTCGAGAAATCTGTCGCAGTTCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4860s21c1
Sequence:CCGGCAAGAACTTGTGCGACAATATCTCGAGATATTGTCGCACAAGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-4639s21c1
Sequence:CCGGGCAAAGAGTTAGGCGAATATACTCGAGTATATTCGCCTAACTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194462.2-744s21c1
Sequence:CCGGGAATTTGAAGCCGCCATTAAACTCGAGTTTAATGGCGGCTTCAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-11623s1c1
Sequence:CCGGGCAGCAGCACATGAAGACAAACTCGAGTTTGTCTTCATGTGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6865s1c1
Sequence:CCGGCGGTTAAATGAGCAGTTTATACTCGAGTATAAACTGCTCATTTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-6864s1c1
Sequence:CCGGCCGGTTAAATGAGCAGTTTATCTCGAGATAAACTGCTCATTTAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194462.1-9842s1c1
Sequence:CCGGGCCGCATAGTAGAACTGTTAACTCGAGTTAACAGTTCTACTATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_194462.1-3701s1c1
Sequence:CCGGGCCCAGAATTACAAGAGTATACTCGAGTATACTCTTGTAATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005751
VALIDATED
AKAP9 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein (yotiao) 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-12048s21c1
Sequence:CCGGTATGAACACAGCTTATGATTGCTCGAGCAATCATAAGCTGTGTTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-10695s21c1
Sequence:CCGGAGAATCAAACTACGCTAAATTCTCGAGAATTTAGCGTAGTTTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-9919s21c1
Sequence:CCGGCGCAGTGAAGAACGGGATAAACTCGAGTTTATCCCGTTCTTCACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-5513s21c1
Sequence:CCGGAGTCATCTGCCAGCCTAATTTCTCGAGAAATTAGGCTGGCAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-3603s21c1
Sequence:CCGGTGTGGATCAGGTTCGTGAATACTCGAGTATTCACGAACCTGATCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-4857s1c1
Sequence:CCGGGCTGACTATTTCAGAAGAAATCTCGAGATTTCTTCTGAAATAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-3653s1c1
Sequence:CCGGGCAGTCTTAAAGAAGAGCTTACTCGAGTAAGCTCTTCTTTAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005751.3-2615s1c1
Sequence:CCGGGCCAAGAAGAAAGATTGATTTCTCGAGAAATCAATCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-9517s1c1
Sequence:CCGGGCACAAATGAATGGTAGGAAACTCGAGTTTCCTACCATTCATTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005751
VALIDATED
AKAP9 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein (yotiao) 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-12048s21c1
Sequence:CCGGTATGAACACAGCTTATGATTGCTCGAGCAATCATAAGCTGTGTTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-10695s21c1
Sequence:CCGGAGAATCAAACTACGCTAAATTCTCGAGAATTTAGCGTAGTTTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-9919s21c1
Sequence:CCGGCGCAGTGAAGAACGGGATAAACTCGAGTTTATCCCGTTCTTCACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-5513s21c1
Sequence:CCGGAGTCATCTGCCAGCCTAATTTCTCGAGAAATTAGGCTGGCAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-3603s21c1
Sequence:CCGGTGTGGATCAGGTTCGTGAATACTCGAGTATTCACGAACCTGATCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-4857s1c1
Sequence:CCGGGCTGACTATTTCAGAAGAAATCTCGAGATTTCTTCTGAAATAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-3653s1c1
Sequence:CCGGGCAGTCTTAAAGAAGAGCTTACTCGAGTAAGCTCTTCTTTAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005751.3-2615s1c1
Sequence:CCGGGCCAAGAAGAAAGATTGATTTCTCGAGAAATCAATCTTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-9517s1c1
Sequence:CCGGGCACAAATGAATGGTAGGAAACTCGAGTTTCCTACCATTCATTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005751
VALIDATED
AKAP9 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein (yotiao) 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-12048s21c1
Sequence:CCGGTATGAACACAGCTTATGATTGCTCGAGCAATCATAAGCTGTGTTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-10695s21c1
Sequence:CCGGAGAATCAAACTACGCTAAATTCTCGAGAATTTAGCGTAGTTTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-9919s21c1
Sequence:CCGGCGCAGTGAAGAACGGGATAAACTCGAGTTTATCCCGTTCTTCACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005751.3-5513s21c1
Sequence:CCGGAGTCATCTGCCAGCCTAATTTCTCGAGAAATTAGGCTGGCAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005751.3-3603s21c1
Sequence:CCGGTGTGGATCAGGTTCGTGAATACTCGAGTATTCACGAACCTGATCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-4857s1c1
Sequence:CCGGGCTGACTATTTCAGAAGAAATCTCGAGATTTCTTCTGAAATAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-3653s1c1
Sequence:CCGGGCAGTCTTAAAGAAGAGCTTACTCGAGTAAGCTCTTCTTTAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005751.3-2615s1c1
Sequence:CCGGGCCAAGAAGAAAGATTGATTTCTCGAGAAATCAATCTTTCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005751.3-9517s1c1
Sequence:CCGGGCACAAATGAATGGTAGGAAACTCGAGTTTCCTACCATTCATTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)