EMAIL THIS PAGE TO A FRIEND

AKIP1

A kinase (PRKA) interacting protein 1

86 Gene Product Result for
Synonyms: BCA3 C11orf17
UniProtKB ID: Q9NQ31, Q8NBS2, Q8TAC6, Q8TAD3, Q8TAE0
Gene ID:
Human(56672) Summary: This gene encodes a nuclear protein that interacts with protein kinase A catalytic subunit, and regulates the effect of the cAMP-dependent protein kinase signaling pathway on the NF-kappa-B activation cascade. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(57373) A kinase (PRKA) interacting protein 1
Rat(361624) A kinase (PRKA) interacting protein 1
chicken(423054) A kinase (PRKA) interacting protein 1
cow(504225) A kinase (PRKA) interacting protein 1
domestic cat(101090644) A kinase (PRKA) interacting protein 1
dog(611400) A kinase (PRKA) interacting protein 1
naked mole-rat(101725917) A kinase (PRKA) interacting protein 1
domestic guinea pig(100729864) A kinase (PRKA) interacting protein 1
sheep(101107130) A kinase (PRKA) interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020642 Rosetta Predictions human pricing
NM_182901 Rosetta Predictions human pricing
NM_001108497 Rosetta Predictions rat pricing
NM_020616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353620 predicted 512
2 SASI_Hs01_00049013 predicted 512
3 SASI_Hs01_00049014 predicted 571
4 SASI_Hs01_00049015 predicted 600
5 SASI_Hs01_00049016 predicted 626
6 SASI_Hs01_00049017 predicted 579
7 SASI_Hs01_00049019 predicted 577
8 SASI_Hs01_00049020 predicted 584
9 SASI_Hs01_00049021 predicted 600
10 SASI_Hs01_00049022 predicted 623
11 SASI_Hs01_00049018 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370996 predicted 630
2 SASI_Hs02_00370997 predicted 623
3 SASI_Hs01_00069854 predicted 691
4 SASI_Hs01_00069855 predicted 725
5 SASI_Hs02_00370998 predicted 748
6 SASI_Hs01_00069856 predicted 693
7 SASI_Hs02_00370999 predicted 696
8 SASI_Hs01_00069857 predicted 700
9 SASI_Hs01_00069859 predicted 723
10 SASI_Hs01_00069860 predicted 746
11 SASI_Hs01_00069858 predicted 736
12 SASI_Hs01_00069861 predicted 693
13 SASI_Hs01_00069862 predicted 676
14 SASI_Hs01_00069863 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239229 predicted 899
2 SASI_Rn02_00239230 predicted 487
3 SASI_Rn02_00239231 predicted 788
4 SASI_Rn02_00239232 predicted 462
5 SASI_Rn02_00239233 predicted 735
6 SASI_Rn02_00239234 predicted 690
7 SASI_Rn02_00239235 predicted 752
8 SASI_Rn02_00239236 predicted 969
9 SASI_Rn02_00239237 predicted 766
10 SASI_Rn02_00239238 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057258 predicted 746
2 SASI_Mm01_00057259 predicted 309
3 SASI_Mm01_00057260 predicted 432
4 SASI_Mm01_00057261 predicted 738
5 SASI_Mm01_00057262 predicted 271
6 SASI_Mm01_00057263 predicted 318
7 SASI_Mm02_00325740 predicted 486
8 SASI_Mm02_00325741 predicted 732
9 SASI_Mm01_00057264 predicted 340
10 SASI_Mm02_00325742 predicted 494
11 SASI_Mm01_00057257 predicted 391
12 SASI_Mm01_00057265 predicted 698
13 SASI_Mm01_00057266 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020616
VALIDATED
AKIP1 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) interacting protein 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020616.1-738s1c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-342s1c1
Sequence:CCGGGTGGGAAATACTACTTGTCTACTCGAGTAGACAAGTAGTATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-343s1c1
Sequence:CCGGTGGGAAATACTACTTGTCTATCTCGAGATAGACAAGTAGTATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-538s1c1
Sequence:CCGGGCCTACTGAGAACATCTCTAACTCGAGTTAGAGATGTTCTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-380s1c1
Sequence:CCGGGCAACCCATGTCTACCGTTATCTCGAGATAACGGTAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-537s21c1
Sequence:CCGGGGCCTACTGAGAACATCTCTACTCGAGTAGAGATGTTCTCAGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-332s21c1
Sequence:CCGGTCAAGTCAGTGTGGGAAATACCTCGAGGTATTTCCCACACTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-289s21c1
Sequence:CCGGTAGCTCTTCCTTCGGAGCAATCTCGAGATTGCTCCGAAGGAAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-574s21c1
Sequence:CCGGAGTCTACCCAGGGACCTATTCCTCGAGGAATAGGTCCCTGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-478s21c1
Sequence:CCGGGACATCTGTTGGACAAGAAAGCTCGAGCTTTCTTGTCCAACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-685s21c1
Sequence:CCGGATGTTGACCGTCACTACCAACCTCGAGGTTGGTAGTGACGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-738s21c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-381s21c1
Sequence:CCGGCAACCCATGTCTACCGTTATCCTCGAGGATAACGGTAGACATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020616
VALIDATED
AKIP1 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) interacting protein 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020616.1-738s1c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-342s1c1
Sequence:CCGGGTGGGAAATACTACTTGTCTACTCGAGTAGACAAGTAGTATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-343s1c1
Sequence:CCGGTGGGAAATACTACTTGTCTATCTCGAGATAGACAAGTAGTATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-538s1c1
Sequence:CCGGGCCTACTGAGAACATCTCTAACTCGAGTTAGAGATGTTCTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-380s1c1
Sequence:CCGGGCAACCCATGTCTACCGTTATCTCGAGATAACGGTAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-537s21c1
Sequence:CCGGGGCCTACTGAGAACATCTCTACTCGAGTAGAGATGTTCTCAGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-332s21c1
Sequence:CCGGTCAAGTCAGTGTGGGAAATACCTCGAGGTATTTCCCACACTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-289s21c1
Sequence:CCGGTAGCTCTTCCTTCGGAGCAATCTCGAGATTGCTCCGAAGGAAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-574s21c1
Sequence:CCGGAGTCTACCCAGGGACCTATTCCTCGAGGAATAGGTCCCTGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-478s21c1
Sequence:CCGGGACATCTGTTGGACAAGAAAGCTCGAGCTTTCTTGTCCAACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-685s21c1
Sequence:CCGGATGTTGACCGTCACTACCAACCTCGAGGTTGGTAGTGACGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-738s21c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-381s21c1
Sequence:CCGGCAACCCATGTCTACCGTTATCCTCGAGGATAACGGTAGACATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020616
VALIDATED
AKIP1 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) interacting protein 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020616.1-738s1c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-342s1c1
Sequence:CCGGGTGGGAAATACTACTTGTCTACTCGAGTAGACAAGTAGTATTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-343s1c1
Sequence:CCGGTGGGAAATACTACTTGTCTATCTCGAGATAGACAAGTAGTATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-538s1c1
Sequence:CCGGGCCTACTGAGAACATCTCTAACTCGAGTTAGAGATGTTCTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020616.1-380s1c1
Sequence:CCGGGCAACCCATGTCTACCGTTATCTCGAGATAACGGTAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-537s21c1
Sequence:CCGGGGCCTACTGAGAACATCTCTACTCGAGTAGAGATGTTCTCAGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-332s21c1
Sequence:CCGGTCAAGTCAGTGTGGGAAATACCTCGAGGTATTTCCCACACTGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-289s21c1
Sequence:CCGGTAGCTCTTCCTTCGGAGCAATCTCGAGATTGCTCCGAAGGAAGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-574s21c1
Sequence:CCGGAGTCTACCCAGGGACCTATTCCTCGAGGAATAGGTCCCTGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-478s21c1
Sequence:CCGGGACATCTGTTGGACAAGAAAGCTCGAGCTTTCTTGTCCAACAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-685s21c1
Sequence:CCGGATGTTGACCGTCACTACCAACCTCGAGGTTGGTAGTGACGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-738s21c1
Sequence:CCGGCCACCCTATAATTGCCTTAATCTCGAGATTAAGGCAATTATAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020616.1-381s21c1
Sequence:CCGGCAACCCATGTCTACCGTTATCCTCGAGGATAACGGTAGACATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020642
VALIDATED
AKIP1 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-762s1c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-413s1c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-584s1c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-331s1c1
Sequence:CCGGCTTCAGAACAATGGCTGAATTCTCGAGAATTCAGCCATTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-330s1c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-584s21c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-413s21c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-330s21c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020642.3-762s21c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020642
VALIDATED
AKIP1 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-762s1c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-413s1c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-584s1c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-331s1c1
Sequence:CCGGCTTCAGAACAATGGCTGAATTCTCGAGAATTCAGCCATTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-330s1c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-584s21c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-413s21c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-330s21c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020642.3-762s21c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020642
VALIDATED
AKIP1 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-762s1c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-413s1c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-584s1c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-331s1c1
Sequence:CCGGCTTCAGAACAATGGCTGAATTCTCGAGAATTCAGCCATTGTTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020642.2-330s1c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-584s21c1
Sequence:CCGGGACCTCTACATAGAAGTATATCTCGAGATATACTTCTATGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-413s21c1
Sequence:CCGGGCAACCCATGTCTATCGTTATCTCGAGATAACGATAGACATGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020642.3-330s21c1
Sequence:CCGGCCTTCAGAACAATGGCTGAATCTCGAGATTCAGCCATTGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020642.3-762s21c1
Sequence:CCGGCCACTGTATGATTCTCTTAATCTCGAGATTAAGAGAATCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks