EMAIL THIS PAGE TO A FRIEND

AKIRIN1

akirin 1

126 Gene Product Result for
Synonyms: C1orf108 RP11-781D11.2 STRF2
UniProtKB ID: Q9H9L7, B4DZU6, Q0VDB3, Q53FK8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024595 Rosetta Predictions human pricing
NM_001030054 Rosetta Predictions rat pricing
NM_023423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173316 predicted 693
2 SASI_Hs01_00173317 predicted 673
3 SASI_Hs01_00173319 predicted 383
4 SASI_Hs01_00173320 predicted 705
5 SASI_Hs01_00173322 predicted 621
6 SASI_Hs01_00173323 predicted 697
7 SASI_Hs01_00173324 predicted 431
8 SASI_Hs01_00173325 predicted 436
9 SASI_Hs02_00356935 predicted 533
10 SASI_Hs02_00356936 predicted 520
11 SASI_Hs01_00173318 predicted 687
12 SASI_Hs01_00173321 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070310 predicted 688
2 SASI_Rn01_00070311 predicted 490
3 SASI_Rn01_00070313 predicted 738
4 SASI_Rn02_00203562 predicted 576
5 SASI_Rn01_00070314 predicted 351
6 SASI_Rn01_00070315 predicted 483
7 SASI_Rn02_00203563 predicted 477
8 SASI_Rn01_00070317 predicted 585
9 SASI_Rn01_00070318 predicted 651
10 SASI_Rn02_00203564 predicted 556
11 SASI_Rn01_00070312 predicted 720
12 SASI_Rn01_00070316 predicted 641
13 SASI_Rn01_00070319 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190789 predicted 403
2 SASI_Mm01_00190790 predicted 521
3 SASI_Mm01_00190791 predicted 460
4 SASI_Mm01_00190792 predicted 434
5 SASI_Mm01_00190793 predicted 511
6 SASI_Mm01_00190794 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023423
VALIDATED
AKIRIN1 MISSION shRNA Bacterial Glycerol Stock
akirin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-548s21c1
Sequence:CCGGTAATATGTGAGCGTCTCTTAACTCGAGTTAAGAGACGCTCACATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-588s21c1
Sequence:CCGGCCGAGAGGAGTATGAGCAAATCTCGAGATTTGCTCATACTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023423.3-1204s1c1
Sequence:CCGGGTTGTAACAGTGGGTTGTTTACTCGAGTAAACAACCCACTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.3-686s1c1
Sequence:CCGGCAAGGCCAACAAGCTATGTATCTCGAGATACATAGCTTGTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-391s21c1
Sequence:CCGGTACCAGAGATGGAGACATTTACTCGAGTAAATGTCTCCATCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-1134s21c1
Sequence:CCGGTGCACGACAATTATGGTTAAACTCGAGTTTAACCATAATTGTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-341s21c1
Sequence:CCGGTTCCAACTCCCGAGCAAATTTCTCGAGAAATTTGCTCGGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-671s1c1
Sequence:CCGGGCAGAACAGTATGAATCGTTTCTCGAGAAACGATTCATACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-434s1c1
Sequence:CCGGCGTTACCAGAGATGGAGACATCTCGAGATGTCTCCATCTCTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023423
VALIDATED
AKIRIN1 MISSION shRNA shRNA Plasmid DNA
akirin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-548s21c1
Sequence:CCGGTAATATGTGAGCGTCTCTTAACTCGAGTTAAGAGACGCTCACATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-588s21c1
Sequence:CCGGCCGAGAGGAGTATGAGCAAATCTCGAGATTTGCTCATACTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023423.3-1204s1c1
Sequence:CCGGGTTGTAACAGTGGGTTGTTTACTCGAGTAAACAACCCACTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.3-686s1c1
Sequence:CCGGCAAGGCCAACAAGCTATGTATCTCGAGATACATAGCTTGTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-391s21c1
Sequence:CCGGTACCAGAGATGGAGACATTTACTCGAGTAAATGTCTCCATCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-1134s21c1
Sequence:CCGGTGCACGACAATTATGGTTAAACTCGAGTTTAACCATAATTGTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-341s21c1
Sequence:CCGGTTCCAACTCCCGAGCAAATTTCTCGAGAAATTTGCTCGGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-671s1c1
Sequence:CCGGGCAGAACAGTATGAATCGTTTCTCGAGAAACGATTCATACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-434s1c1
Sequence:CCGGCGTTACCAGAGATGGAGACATCTCGAGATGTCTCCATCTCTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023423
VALIDATED
AKIRIN1 MISSION shRNA Lentiviral Transduction Particles
akirin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-548s21c1
Sequence:CCGGTAATATGTGAGCGTCTCTTAACTCGAGTTAAGAGACGCTCACATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-588s21c1
Sequence:CCGGCCGAGAGGAGTATGAGCAAATCTCGAGATTTGCTCATACTCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023423.3-1204s1c1
Sequence:CCGGGTTGTAACAGTGGGTTGTTTACTCGAGTAAACAACCCACTGTTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.3-686s1c1
Sequence:CCGGCAAGGCCAACAAGCTATGTATCTCGAGATACATAGCTTGTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-391s21c1
Sequence:CCGGTACCAGAGATGGAGACATTTACTCGAGTAAATGTCTCCATCTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-1134s21c1
Sequence:CCGGTGCACGACAATTATGGTTAAACTCGAGTTTAACCATAATTGTCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023423.3-341s21c1
Sequence:CCGGTTCCAACTCCCGAGCAAATTTCTCGAGAAATTTGCTCGGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-671s1c1
Sequence:CCGGGCAGAACAGTATGAATCGTTTCTCGAGAAACGATTCATACTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023423.2-434s1c1
Sequence:CCGGCGTTACCAGAGATGGAGACATCTCGAGATGTCTCCATCTCTGGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024595
VALIDATED
AKIRIN1 MISSION shRNA Bacterial Glycerol Stock
akirin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-345s1c1
Sequence:CCGGTTCCAACTCCGGAGCAAATTTCTCGAGAAATTTGCTCCGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-655s1c1
Sequence:CCGGATTCACACATGATCAGATTATCTCGAGATAATCTGATCATGTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-694s1c1
Sequence:CCGGGCCAACAAGCTATGTGTCATGCTCGAGCATGACACATAGCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1046s1c1
Sequence:CCGGCGTGTGAGAGTGTGTGTATATCTCGAGATATACACACACTCTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-599s1c1
Sequence:CCGGGAGTATGAGCAAATCCTCAATCTCGAGATTGAGGATTTGCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-886s1c1
Sequence:CCGGGCCACAAGCATATCTTTCTTTCTCGAGAAAGAAAGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-605s1c1
Sequence:CCGGGAGCAAATCCTCAATACCAAACTCGAGTTTGGTATTGAGGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1366s1c1
Sequence:CCGGCGTGGTGAGAAATTAGAACAACTCGAGTTGTTCTAATTTCTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1178s1c1
Sequence:CCGGGCTTGGTCTAAAGAAGATCATCTCGAGATGATCTTCTTTAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-535s1c1
Sequence:CCGGCCTCCGACAAGTTGGCATAATCTCGAGATTATGCCAACTTGTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024595
VALIDATED
AKIRIN1 MISSION shRNA shRNA Plasmid DNA
akirin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-345s1c1
Sequence:CCGGTTCCAACTCCGGAGCAAATTTCTCGAGAAATTTGCTCCGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-655s1c1
Sequence:CCGGATTCACACATGATCAGATTATCTCGAGATAATCTGATCATGTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-694s1c1
Sequence:CCGGGCCAACAAGCTATGTGTCATGCTCGAGCATGACACATAGCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1046s1c1
Sequence:CCGGCGTGTGAGAGTGTGTGTATATCTCGAGATATACACACACTCTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-599s1c1
Sequence:CCGGGAGTATGAGCAAATCCTCAATCTCGAGATTGAGGATTTGCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-886s1c1
Sequence:CCGGGCCACAAGCATATCTTTCTTTCTCGAGAAAGAAAGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-605s1c1
Sequence:CCGGGAGCAAATCCTCAATACCAAACTCGAGTTTGGTATTGAGGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1366s1c1
Sequence:CCGGCGTGGTGAGAAATTAGAACAACTCGAGTTGTTCTAATTTCTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1178s1c1
Sequence:CCGGGCTTGGTCTAAAGAAGATCATCTCGAGATGATCTTCTTTAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-535s1c1
Sequence:CCGGCCTCCGACAAGTTGGCATAATCTCGAGATTATGCCAACTTGTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024595
VALIDATED
AKIRIN1 MISSION shRNA Lentiviral Transduction Particles
akirin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-345s1c1
Sequence:CCGGTTCCAACTCCGGAGCAAATTTCTCGAGAAATTTGCTCCGGAGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-655s1c1
Sequence:CCGGATTCACACATGATCAGATTATCTCGAGATAATCTGATCATGTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-694s1c1
Sequence:CCGGGCCAACAAGCTATGTGTCATGCTCGAGCATGACACATAGCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136590    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1046s1c1
Sequence:CCGGCGTGTGAGAGTGTGTGTATATCTCGAGATATACACACACTCTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024595.1-599s1c1
Sequence:CCGGGAGTATGAGCAAATCCTCAATCTCGAGATTGAGGATTTGCTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-886s1c1
Sequence:CCGGGCCACAAGCATATCTTTCTTTCTCGAGAAAGAAAGATATGCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024595.1-605s1c1
Sequence:CCGGGAGCAAATCCTCAATACCAAACTCGAGTTTGGTATTGAGGATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1366s1c1
Sequence:CCGGCGTGGTGAGAAATTAGAACAACTCGAGTTGTTCTAATTTCTCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-1178s1c1
Sequence:CCGGGCTTGGTCTAAAGAAGATCATCTCGAGATGATCTTCTTTAGACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024595.1-535s1c1
Sequence:CCGGCCTCCGACAAGTTGGCATAATCTCGAGATTATGCCAACTTGTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks