EMAIL THIS PAGE TO A FRIEND

AKIRIN2

akirin 2

66 Gene Product Result for
Synonyms: C6orf166 FBI1 dJ486L4.2
UniProtKB ID: Q53H80, Q9BQB1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136031 MISSION® esiRNA esiRNA human AKIRIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018064 Rosetta Predictions human pricing
NM_001039914 Rosetta Predictions rat pricing
NM_001007589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157302 predicted 961
2 SASI_Hs01_00157304 predicted 1070
3 SASI_Hs01_00157307 predicted 938
4 SASI_Hs01_00157309 predicted 963
5 SASI_Hs01_00157310 predicted 1170
6 SASI_Hs02_00351207 predicted 1224
7 SASI_Hs01_00157301 predicted 1158
8 SASI_Hs02_00351208 predicted 1069
9 SASI_Hs01_00157303 predicted 1109
10 SASI_Hs01_00157305 predicted 1189
11 SASI_Hs01_00157306 predicted 1124
12 SASI_Hs01_00157308 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047124 predicted 1229
2 SASI_Rn01_00047126 predicted 1235
3 SASI_Rn01_00047127 predicted 780
4 SASI_Rn01_00047128 predicted 1043
5 SASI_Rn01_00047129 predicted 1140
6 SASI_Rn01_00047130 predicted 1223
7 SASI_Rn01_00047132 predicted 609
8 SASI_Rn02_00204886 predicted 684
9 SASI_Rn02_00204887 predicted 1141
10 SASI_Rn01_00047133 predicted 1178
11 SASI_Rn01_00047125 predicted 1210
12 SASI_Rn01_00047131 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058168 predicted 1088
2 SASI_Mm01_00058169 predicted 1323
3 SASI_Mm01_00058170 predicted 865
4 SASI_Mm01_00058171 predicted 1308
5 SASI_Mm01_00058172 predicted 1122
6 SASI_Mm02_00286765 predicted 836
7 SASI_Mm01_00058173 predicted 808
8 SASI_Mm01_00058174 predicted 971
9 SASI_Mm01_00058175 predicted 1221
10 SASI_Mm01_00058176 predicted 1273
11 SASI_Mm01_00058177 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018064
VALIDATED
AKIRIN2 MISSION shRNA Bacterial Glycerol Stock
akirin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-1086s1c1
Sequence:CCGGGATCAAATAATGCGACGATATCTCGAGATATCGTCGCATTATTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-808s1c1
Sequence:CCGGGAAGACATTTAGAAACGAGTTCTCGAGAACTCGTTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-755s1c1
Sequence:CCGGCACAGAACAAATTCTGTACAACTCGAGTTGTACAGAATTTGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-869s21c1
Sequence:CCGGAGACATTTAGAAACGAGTTTCCTCGAGGAAACTCGTTTCTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-1183s1c1
Sequence:CCGGTTGCAAGAGGTCCCAATTATGCTCGAGCATAATTGGGACCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-755s21c1
Sequence:CCGGCCGCAGAAGTATCTCCGAATGCTCGAGCATTCGGAGATACTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1132s21c1
Sequence:CCGGGAAGTTTACGCATGATCAAATCTCGAGATTTGATCATGCGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1110s21c1
Sequence:CCGGCAGAACAATATGATGCGTTTGCTCGAGCAAACGCATCATATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-914s1c1
Sequence:CCGGTGCAGCATCCTCACCATTAAACTCGAGTTTAATGGTGAGGATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1171s21c1
Sequence:CCGGACAGCCTGCTAGCTATGTTTCCTCGAGGAAACATAGCTAGCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1193s21c1
Sequence:CCGGTGAATCACGTATCCTGCATTTCTCGAGAAATGCAGGATACGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018064
VALIDATED
AKIRIN2 MISSION shRNA shRNA Plasmid DNA
akirin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-1086s1c1
Sequence:CCGGGATCAAATAATGCGACGATATCTCGAGATATCGTCGCATTATTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-808s1c1
Sequence:CCGGGAAGACATTTAGAAACGAGTTCTCGAGAACTCGTTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-755s1c1
Sequence:CCGGCACAGAACAAATTCTGTACAACTCGAGTTGTACAGAATTTGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-869s21c1
Sequence:CCGGAGACATTTAGAAACGAGTTTCCTCGAGGAAACTCGTTTCTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-1183s1c1
Sequence:CCGGTTGCAAGAGGTCCCAATTATGCTCGAGCATAATTGGGACCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-755s21c1
Sequence:CCGGCCGCAGAAGTATCTCCGAATGCTCGAGCATTCGGAGATACTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1132s21c1
Sequence:CCGGGAAGTTTACGCATGATCAAATCTCGAGATTTGATCATGCGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1110s21c1
Sequence:CCGGCAGAACAATATGATGCGTTTGCTCGAGCAAACGCATCATATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-914s1c1
Sequence:CCGGTGCAGCATCCTCACCATTAAACTCGAGTTTAATGGTGAGGATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1171s21c1
Sequence:CCGGACAGCCTGCTAGCTATGTTTCCTCGAGGAAACATAGCTAGCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1193s21c1
Sequence:CCGGTGAATCACGTATCCTGCATTTCTCGAGAAATGCAGGATACGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018064
VALIDATED
AKIRIN2 MISSION shRNA Lentiviral Transduction Particles
akirin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-1086s1c1
Sequence:CCGGGATCAAATAATGCGACGATATCTCGAGATATCGTCGCATTATTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-808s1c1
Sequence:CCGGGAAGACATTTAGAAACGAGTTCTCGAGAACTCGTTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018064.2-755s1c1
Sequence:CCGGCACAGAACAAATTCTGTACAACTCGAGTTGTACAGAATTTGTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-869s21c1
Sequence:CCGGAGACATTTAGAAACGAGTTTCCTCGAGGAAACTCGTTTCTAAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-1183s1c1
Sequence:CCGGTTGCAAGAGGTCCCAATTATGCTCGAGCATAATTGGGACCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-755s21c1
Sequence:CCGGCCGCAGAAGTATCTCCGAATGCTCGAGCATTCGGAGATACTTCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1132s21c1
Sequence:CCGGGAAGTTTACGCATGATCAAATCTCGAGATTTGATCATGCGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1110s21c1
Sequence:CCGGCAGAACAATATGATGCGTTTGCTCGAGCAAACGCATCATATTGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018064.2-914s1c1
Sequence:CCGGTGCAGCATCCTCACCATTAAACTCGAGTTTAATGGTGAGGATGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1171s21c1
Sequence:CCGGACAGCCTGCTAGCTATGTTTCCTCGAGGAAACATAGCTAGCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018064.3-1193s21c1
Sequence:CCGGTGAATCACGTATCCTGCATTTCTCGAGAAATGCAGGATACGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007589
AKIRIN2 MISSION shRNA Bacterial Glycerol Stock
akirin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-383s1c1
Sequence:CCGGCGCATGCAGAAGAGAAGACATCTCGAGATGTCTTCTCTTCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-345s1c1
Sequence:CCGGCAGAACAAATTCTGTACAACACTCGAGTGTTGTACAGAATTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-342s1c1
Sequence:CCGGCCACAGAACAAATTCTGTACACTCGAGTGTACAGAATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-396s1c1
Sequence:CCGGGAAGACATTTAGAAGCTAGTTCTCGAGAACTAGCTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-389s1c1
Sequence:CCGGCAGAAGAGAAGACATTTAGAACTCGAGTTCTAAATGTCTTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007589
AKIRIN2 MISSION shRNA shRNA Plasmid DNA
akirin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-383s1c1
Sequence:CCGGCGCATGCAGAAGAGAAGACATCTCGAGATGTCTTCTCTTCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-345s1c1
Sequence:CCGGCAGAACAAATTCTGTACAACACTCGAGTGTTGTACAGAATTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-342s1c1
Sequence:CCGGCCACAGAACAAATTCTGTACACTCGAGTGTACAGAATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-396s1c1
Sequence:CCGGGAAGACATTTAGAAGCTAGTTCTCGAGAACTAGCTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-389s1c1
Sequence:CCGGCAGAAGAGAAGACATTTAGAACTCGAGTTCTAAATGTCTTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007589
AKIRIN2 MISSION shRNA Lentiviral Transduction Particles
akirin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-383s1c1
Sequence:CCGGCGCATGCAGAAGAGAAGACATCTCGAGATGTCTTCTCTTCTGCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-345s1c1
Sequence:CCGGCAGAACAAATTCTGTACAACACTCGAGTGTTGTACAGAATTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-342s1c1
Sequence:CCGGCCACAGAACAAATTCTGTACACTCGAGTGTACAGAATTTGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-396s1c1
Sequence:CCGGGAAGACATTTAGAAGCTAGTTCTCGAGAACTAGCTTCTAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007589.1-389s1c1
Sequence:CCGGCAGAAGAGAAGACATTTAGAACTCGAGTTCTAAATGTCTTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks