EMAIL THIS PAGE TO A FRIEND

AKNA

AT-hook transcription factor

74 Gene Product Result for
Gene ID:
Mouse(100182) AT-hook transcription factor
Rat(362530) AT-hook transcription factor
cow(539274) AT-hook transcription factor
Horse(100146418) AT-hook transcription factor
domestic cat(101098751) AT-hook transcription factor
dog(481687) AT-hook transcription factor
domestic guinea pig(100713248) AT-hook transcription factor
naked mole-rat(101724430) AT-hook transcription factor
sheep(101118854) AT-hook transcription factor
Domestic Rabbit(100355652) AT-hook transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158951 MISSION® esiRNA esiRNA human AKNA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030767 Rosetta Predictions human pricing
NM_001108668 Rosetta Predictions rat pricing
NM_001045514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190789 predicted 4412
2 SASI_Hs01_00190790 predicted 259
3 SASI_Hs01_00190791 predicted 3599
4 SASI_Hs01_00190793 predicted 4206
5 SASI_Hs02_00358301 predicted 2084
6 SASI_Hs02_00358302 predicted 1522
7 SASI_Hs01_00190794 predicted 242
8 SASI_Hs02_00358303 predicted 3806
9 SASI_Hs02_00358304 predicted 1347
10 SASI_Hs02_00358305 predicted 2133
11 SASI_Hs01_00190786 predicted 1058
12 SASI_Hs01_00190787 predicted 3575
13 SASI_Hs01_00190788 predicted 885
14 SASI_Hs01_00190792 predicted 1002
15 SASI_Hs01_00190795 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240895 predicted 371
2 SASI_Rn02_00240896 predicted 2679
3 SASI_Rn02_00240897 predicted 1581
4 SASI_Rn02_00240898 predicted 2845
5 SASI_Rn02_00240899 predicted 332
6 SASI_Rn02_00240900 predicted 1399
7 SASI_Rn02_00240901 predicted 2674
8 SASI_Rn02_00240902 predicted 4166
9 SASI_Rn02_00240903 predicted 791
10 SASI_Rn02_00240904 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291524 predicted 3753
2 SASI_Mm02_00291525 predicted 1452
3 SASI_Mm02_00291526 predicted 1493
4 SASI_Mm02_00291527 predicted 2802
5 SASI_Mm02_00291528 predicted 2586
6 SASI_Mm02_00291529 predicted 1672
7 SASI_Mm02_00291530 predicted 1219
8 SASI_Mm02_00291531 predicted 3640
9 SASI_Mm02_00291532 predicted 2796
10 SASI_Mm02_00291533 predicted 2669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030767
VALIDATED
AKNA MISSION shRNA Bacterial Glycerol Stock
AT-hook transcription factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-2662s21c1
Sequence:CCGGACGGAGAAGATGGTATCTATGCTCGAGCATAGATACCATCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030767.4-4786s21c1
Sequence:CCGGTCCAGCTAATAATAGGTATTTCTCGAGAAATACCTATTATTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-1079s21c1
Sequence:CCGGCACTCCCTTCCCGATTCATTGCTCGAGCAATGAATCGGGAAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-3004s21c1
Sequence:CCGGATCAGCACAGCAGGAACATTACTCGAGTAATGTTCCTGCTGTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-1056s1c1
Sequence:CCGGGCAGACAAAGACGTCACCTAACTCGAGTTAGGTGACGTCTTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-2945s1c1
Sequence:CCGGGCTCAGAAACAAGCAGAGTTTCTCGAGAAACTCTGCTTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2320s1c1
Sequence:CCGGCCCTGCCCATTGCACGTAAATCTCGAGATTTACGTGCAATGGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2807s1c1
Sequence:CCGGCCCACCAAAGTAGTATGACCACTCGAGTGGTCATACTACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-3813s1c1
Sequence:CCGGCCAATACACAGGCCACGAATACTCGAGTATTCGTGGCCTGTGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030767
VALIDATED
AKNA MISSION shRNA shRNA Plasmid DNA
AT-hook transcription factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-2662s21c1
Sequence:CCGGACGGAGAAGATGGTATCTATGCTCGAGCATAGATACCATCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030767.4-4786s21c1
Sequence:CCGGTCCAGCTAATAATAGGTATTTCTCGAGAAATACCTATTATTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-1079s21c1
Sequence:CCGGCACTCCCTTCCCGATTCATTGCTCGAGCAATGAATCGGGAAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-3004s21c1
Sequence:CCGGATCAGCACAGCAGGAACATTACTCGAGTAATGTTCCTGCTGTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-1056s1c1
Sequence:CCGGGCAGACAAAGACGTCACCTAACTCGAGTTAGGTGACGTCTTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-2945s1c1
Sequence:CCGGGCTCAGAAACAAGCAGAGTTTCTCGAGAAACTCTGCTTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2320s1c1
Sequence:CCGGCCCTGCCCATTGCACGTAAATCTCGAGATTTACGTGCAATGGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2807s1c1
Sequence:CCGGCCCACCAAAGTAGTATGACCACTCGAGTGGTCATACTACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-3813s1c1
Sequence:CCGGCCAATACACAGGCCACGAATACTCGAGTATTCGTGGCCTGTGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030767
VALIDATED
AKNA MISSION shRNA Lentiviral Transduction Particles
AT-hook transcription factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-2662s21c1
Sequence:CCGGACGGAGAAGATGGTATCTATGCTCGAGCATAGATACCATCTTCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030767.4-4786s21c1
Sequence:CCGGTCCAGCTAATAATAGGTATTTCTCGAGAAATACCTATTATTAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-1079s21c1
Sequence:CCGGCACTCCCTTCCCGATTCATTGCTCGAGCAATGAATCGGGAAGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030767.4-3004s21c1
Sequence:CCGGATCAGCACAGCAGGAACATTACTCGAGTAATGTTCCTGCTGTGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-1056s1c1
Sequence:CCGGGCAGACAAAGACGTCACCTAACTCGAGTTAGGTGACGTCTTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-2945s1c1
Sequence:CCGGGCTCAGAAACAAGCAGAGTTTCTCGAGAAACTCTGCTTGTTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2320s1c1
Sequence:CCGGCCCTGCCCATTGCACGTAAATCTCGAGATTTACGTGCAATGGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030767.2-2807s1c1
Sequence:CCGGCCCACCAAAGTAGTATGACCACTCGAGTGGTCATACTACTTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030767.2-3813s1c1
Sequence:CCGGCCAATACACAGGCCACGAATACTCGAGTATTCGTGGCCTGTGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045514
AKNA MISSION shRNA Bacterial Glycerol Stock
AT-hook transcription factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045514.2-4827s21c1
Sequence:GTACCGGATGTGCTTCTGCAGCTAATAACTCGAGTTATTAGCTGCAGAAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-2580s21c1
Sequence:CCGGGAGATACCTCAGCGTTAAATCCTCGAGGATTTAACGCTGAGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-4275s21c1
Sequence:CCGGCATCTCCTCAGCTCCCATTATCTCGAGATAATGGGAGCTGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-1776s21c1
Sequence:CCGGACAAGGAAGCAAGGTCTTATCCTCGAGGATAAGACCTTGCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-3044s21c1
Sequence:CCGGTGGGCTCAGAAACCAGTATAGCTCGAGCTATACTGGTTTCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045514
AKNA MISSION shRNA shRNA Plasmid DNA
AT-hook transcription factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045514.2-4827s21c1
Sequence:GTACCGGATGTGCTTCTGCAGCTAATAACTCGAGTTATTAGCTGCAGAAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-2580s21c1
Sequence:CCGGGAGATACCTCAGCGTTAAATCCTCGAGGATTTAACGCTGAGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-4275s21c1
Sequence:CCGGCATCTCCTCAGCTCCCATTATCTCGAGATAATGGGAGCTGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-1776s21c1
Sequence:CCGGACAAGGAAGCAAGGTCTTATCCTCGAGGATAAGACCTTGCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-3044s21c1
Sequence:CCGGTGGGCTCAGAAACCAGTATAGCTCGAGCTATACTGGTTTCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045514
AKNA MISSION shRNA Lentiviral Transduction Particles
AT-hook transcription factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045514.2-4827s21c1
Sequence:GTACCGGATGTGCTTCTGCAGCTAATAACTCGAGTTATTAGCTGCAGAAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-2580s21c1
Sequence:CCGGGAGATACCTCAGCGTTAAATCCTCGAGGATTTAACGCTGAGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-4275s21c1
Sequence:CCGGCATCTCCTCAGCTCCCATTATCTCGAGATAATGGGAGCTGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-1776s21c1
Sequence:CCGGACAAGGAAGCAAGGTCTTATCCTCGAGGATAAGACCTTGCTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045514.2-3044s21c1
Sequence:CCGGTGGGCTCAGAAACCAGTATAGCTCGAGCTATACTGGTTTCTGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks