EMAIL THIS PAGE TO A FRIEND

AKNAD1

AKNA domain containing 1

Synonyms: C1orf62
UniProtKB ID: Q5T1N1, B9EK62, Q5T1N0, Q8N990, Q8NCN9
Gene ID:
Human(254268) Summary: This gene encodes a protein which contains a domain found in an AT-hook-containing transcription factor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(329738) AKNA domain containing 1
Rat(691416) AKNA domain containing 1
sheep(101102953) AKNA domain containing 1
naked mole-rat(101709642) AKNA domain containing 1
domestic guinea pig(100715841) AKNA domain containing 1
chicken(101747831) AKNA domain containing 1
chicken(101666050) AKNA domain containing 1
domestic cat(101088176) AKNA domain containing 1
Horse(100057931) AKNA domain containing 1
cow(613684) AKNA domain containing 1
dog(479919) AKNA domain containing 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001052094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001052094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001052094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152763 Rosetta Predictions human pricing
NM_001044303 Rosetta Predictions rat pricing
XM_001052094 Rosetta Predictions mouse pricing
XM_001052095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366698 predicted 1292
2 SASI_Hs01_00117819 predicted 989
3 SASI_Hs01_00117821 predicted 1137
4 SASI_Hs02_00366699 predicted 1401
5 SASI_Hs01_00117823 predicted 1153
6 SASI_Hs01_00117824 predicted 1933
7 SASI_Hs01_00117825 predicted 294
8 SASI_Hs01_00117826 predicted 563
9 SASI_Hs01_00117827 predicted 667
10 SASI_Hs02_00366700 predicted 2244
11 SASI_Hs01_00117818 predicted 1487
12 SASI_Hs01_00117820 predicted 1752
13 SASI_Hs01_00117822 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205694 predicted 318
2 SASI_Rn02_00205695 predicted 1484
3 SASI_Rn02_00205696 predicted 336
4 SASI_Rn02_00205697 predicted 877
5 SASI_Rn02_00205698 predicted 985
6 SASI_Rn02_00205699 predicted 1329
7 SASI_Rn02_00205700 predicted 262
8 SASI_Rn02_00205701 predicted 1197
9 SASI_Rn02_00205702 predicted 1258
10 SASI_Rn02_00205703 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356582 predicted 1379
2 SASI_Mm02_00356583 predicted 943
3 SASI_Mm02_00356584 predicted 1545
4 SASI_Mm02_00356585 predicted 625
5 SASI_Mm02_00356586 predicted 1528
6 SASI_Mm02_00356587 predicted 400
7 SASI_Mm02_00356588 predicted 722
8 SASI_Mm02_00356589 predicted 698
9 SASI_Mm02_00356590 predicted 1121
10 SASI_Mm02_00356591 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356592 predicted 335
2 SASI_Mm02_00356593 predicted 338
3 SASI_Mm02_00356594 predicted 358
4 SASI_Mm02_00356595 predicted 337
5 SASI_Mm02_00356596 predicted 355
6 SASI_Mm02_00356597 predicted 362
7 SASI_Mm02_00356598 predicted 359
8 SASI_Mm02_00356599 predicted 356
9 SASI_Mm02_00356600 predicted 337
10 SASI_Mm02_00356601 predicted 390
11 SASI_Mm01_00221977 predicted 367
12 SASI_Mm01_00221978 predicted 266
13 SASI_Mm01_00221979 predicted 409
14 SASI_Mm01_00221980 predicted 283
15 SASI_Mm01_00221981 predicted 600
16 SASI_Mm01_00221982 predicted 585
17 SASI_Mm01_00221983 predicted 209
18 SASI_Mm01_00221984 predicted 686
19 SASI_Mm01_00221985 predicted 411
20 SASI_Mm01_00221986 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152763
AKNAD1 MISSION shRNA Bacterial Glycerol Stock
AKNA domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1724s1c1
Sequence:CCGGGCAAATATACTTCAGCTCCTTCTCGAGAAGGAGCTGAAGTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-288s1c1
Sequence:CCGGCGACTTATAAGCAGGAGGATTCTCGAGAATCCTCCTGCTTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1094s1c1
Sequence:CCGGCCACTTGCAATAGCTAAACAACTCGAGTTGTTTAGCTATTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1179s1c1
Sequence:CCGGCTGAGTCAAACTGTGTTGAAACTCGAGTTTCAACACAGTTTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1931s21c1
Sequence:CCGGGACTTACCTAAACGGTCATTACTCGAGTAATGACCGTTTAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1360s21c1
Sequence:CCGGCCTCAAGTTCTTCTTACATATCTCGAGATATGTAAGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-448s21c1
Sequence:CCGGATAGTGAGACTTGTGGAAATACTCGAGTATTTCCACAAGTCTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-994s21c1
Sequence:CCGGATTCAGGCAACACGTTCAAATCTCGAGATTTGAACGTGTTGCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152763
AKNAD1 MISSION shRNA shRNA Plasmid DNA
AKNA domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1724s1c1
Sequence:CCGGGCAAATATACTTCAGCTCCTTCTCGAGAAGGAGCTGAAGTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-288s1c1
Sequence:CCGGCGACTTATAAGCAGGAGGATTCTCGAGAATCCTCCTGCTTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1094s1c1
Sequence:CCGGCCACTTGCAATAGCTAAACAACTCGAGTTGTTTAGCTATTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1179s1c1
Sequence:CCGGCTGAGTCAAACTGTGTTGAAACTCGAGTTTCAACACAGTTTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1931s21c1
Sequence:CCGGGACTTACCTAAACGGTCATTACTCGAGTAATGACCGTTTAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1360s21c1
Sequence:CCGGCCTCAAGTTCTTCTTACATATCTCGAGATATGTAAGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-448s21c1
Sequence:CCGGATAGTGAGACTTGTGGAAATACTCGAGTATTTCCACAAGTCTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-994s21c1
Sequence:CCGGATTCAGGCAACACGTTCAAATCTCGAGATTTGAACGTGTTGCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152763
AKNAD1 MISSION shRNA Lentiviral Transduction Particles
AKNA domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1724s1c1
Sequence:CCGGGCAAATATACTTCAGCTCCTTCTCGAGAAGGAGCTGAAGTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-288s1c1
Sequence:CCGGCGACTTATAAGCAGGAGGATTCTCGAGAATCCTCCTGCTTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1094s1c1
Sequence:CCGGCCACTTGCAATAGCTAAACAACTCGAGTTGTTTAGCTATTGCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152763.2-1179s1c1
Sequence:CCGGCTGAGTCAAACTGTGTTGAAACTCGAGTTTCAACACAGTTTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1931s21c1
Sequence:CCGGGACTTACCTAAACGGTCATTACTCGAGTAATGACCGTTTAGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-1360s21c1
Sequence:CCGGCCTCAAGTTCTTCTTACATATCTCGAGATATGTAAGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-448s21c1
Sequence:CCGGATAGTGAGACTTGTGGAAATACTCGAGTATTTCCACAAGTCTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152763.3-994s21c1
Sequence:CCGGATTCAGGCAACACGTTCAAATCTCGAGATTTGAACGTGTTGCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177859
AKNAD1 MISSION shRNA Bacterial Glycerol Stock
AKNA domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-952s1c1
Sequence:CCGGGCTCAAGTGCACTACCAGTTTCTCGAGAAACTGGTAGTGCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1150s1c1
Sequence:CCGGCCTGAACCTTCGCAACAAATACTCGAGTATTTGTTGCGAAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177859.2-1049s1c1
Sequence:CCGGCTCCGAGGTTGACGAATAAATCTCGAGATTTATTCGTCAACCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177859.2-1564s1c1
Sequence:CCGGGCTGGGCTACATAAGATCCTACTCGAGTAGGATCTTATGTAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1232s1c1
Sequence:CCGGGTTGCTTGAATTTGACACCAACTCGAGTTGGTGTCAAATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-491s1c1
Sequence:CCGGCTGATAAAGAAGATACCTCAACTCGAGTTGAGGTATCTTCTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177859
AKNAD1 MISSION shRNA shRNA Plasmid DNA
AKNA domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-952s1c1
Sequence:CCGGGCTCAAGTGCACTACCAGTTTCTCGAGAAACTGGTAGTGCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1150s1c1
Sequence:CCGGCCTGAACCTTCGCAACAAATACTCGAGTATTTGTTGCGAAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177859.2-1049s1c1
Sequence:CCGGCTCCGAGGTTGACGAATAAATCTCGAGATTTATTCGTCAACCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177859.2-1564s1c1
Sequence:CCGGGCTGGGCTACATAAGATCCTACTCGAGTAGGATCTTATGTAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1232s1c1
Sequence:CCGGGTTGCTTGAATTTGACACCAACTCGAGTTGGTGTCAAATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-491s1c1
Sequence:CCGGCTGATAAAGAAGATACCTCAACTCGAGTTGAGGTATCTTCTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177859
AKNAD1 MISSION shRNA Lentiviral Transduction Particles
AKNA domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-952s1c1
Sequence:CCGGGCTCAAGTGCACTACCAGTTTCTCGAGAAACTGGTAGTGCACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1150s1c1
Sequence:CCGGCCTGAACCTTCGCAACAAATACTCGAGTATTTGTTGCGAAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177859.2-1049s1c1
Sequence:CCGGCTCCGAGGTTGACGAATAAATCTCGAGATTTATTCGTCAACCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177859.2-1564s1c1
Sequence:CCGGGCTGGGCTACATAAGATCCTACTCGAGTAGGATCTTATGTAGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-1232s1c1
Sequence:CCGGGTTGCTTGAATTTGACACCAACTCGAGTTGGTGTCAAATTCAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177859.2-491s1c1
Sequence:CCGGCTGATAAAGAAGATACCTCAACTCGAGTTGAGGTATCTTCTTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001052094
AKNAD1 MISSION shRNA Bacterial Glycerol Stock
AKNA domain containing 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000217469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-1959s1c1
Sequence:CCGGGTCCAGCCTCACTTCTTATATCTCGAGATATAAGAAGTGAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-973s1c1
Sequence:CCGGCTAAAGGTCCAGGTGATAAATCTCGAGATTTATCACCTGGACCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001052094
AKNAD1 MISSION shRNA shRNA Plasmid DNA
AKNA domain containing 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000217469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-1959s1c1
Sequence:CCGGGTCCAGCCTCACTTCTTATATCTCGAGATATAAGAAGTGAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-973s1c1
Sequence:CCGGCTAAAGGTCCAGGTGATAAATCTCGAGATTTATCACCTGGACCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001052094
AKNAD1 MISSION shRNA Lentiviral Transduction Particles
AKNA domain containing 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000217469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-1959s1c1
Sequence:CCGGGTCCAGCCTCACTTCTTATATCTCGAGATATAAGAAGTGAGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001052094.2-973s1c1
Sequence:CCGGCTAAAGGTCCAGGTGATAAATCTCGAGATTTATCACCTGGACCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks