EMAIL THIS PAGE TO A FRIEND

AKR1A1

aldo-keto reductase family 1, member A1 (aldehyde reductase)

103 Gene Product Result for
Synonyms: ALDR1 ALR ARM DD3
UniProtKB ID: P14550, A8KAL8, D3DQ04, Q6IAZ4
Gene ID:
Human(10327) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
Mouse(58810) aldo-keto reductase family 1, member A1 (aldehyde reductase)
Rat(78959) aldo-keto reductase family 1, member A1 (aldehyde reductase)
naked mole-rat(101710959) aldo-keto reductase family 1, member A1 (aldehyde reductase)
domestic guinea pig(100735047) aldo-keto reductase family 1, member A1 (aldehyde reductase)
sheep(101121637) aldo-keto reductase family 1, member A1 (aldehyde reductase)
chicken(424599) aldo-keto reductase family 1, member A1 (aldehyde reductase)
cow(618607) aldo-keto reductase family 1, member A1 (aldehyde reductase)
Horse(100052360) aldo-keto reductase family 1, member A1 (aldehyde reductase)
domestic cat(101091464) aldo-keto reductase family 1, member A1 (aldehyde reductase)
dog(610537) aldo-keto reductase family 1, member A1 (aldehyde reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153326 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006066 Rosetta Predictions human pricing
NM_153326 Rosetta Predictions human pricing
NM_031000 Rosetta Predictions rat pricing
NM_021473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063098 predicted 837
2 SASI_Hs01_00063099 predicted 1120
3 SASI_Hs01_00063100 predicted 845
4 SASI_Hs01_00063101 predicted 964
5 SASI_Hs01_00063102 predicted 842
6 SASI_Hs01_00063103 predicted 1281
7 SASI_Hs01_00063104 predicted 1073
8 SASI_Hs01_00063105 predicted 835
9 SASI_Hs01_00063106 predicted 861
10 SASI_Hs02_00340832 predicted 1093
11 SASI_Hs01_00063107 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073662 predicted 706
2 SASI_Hs01_00073663 predicted 989
3 SASI_Hs01_00073664 predicted 726
4 SASI_Hs01_00073665 predicted 831
5 SASI_Hs01_00073666 predicted 712
6 SASI_Hs01_00073667 predicted 1152
7 SASI_Hs01_00073668 predicted 953
8 SASI_Hs01_00073669 predicted 709
9 SASI_Hs01_00073670 predicted 732
10 SASI_Hs02_00367177 predicted 967
11 SASI_Hs01_00073671 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264174 predicted 802
2 SASI_Rn01_00099409 predicted 349
3 SASI_Rn01_00099410 predicted 366
4 SASI_Rn02_00264175 predicted 744
5 SASI_Rn01_00099412 predicted 843
6 SASI_Rn01_00099413 predicted 232
7 SASI_Rn01_00099414 predicted 691
8 SASI_Rn02_00264176 predicted 889
9 SASI_Rn02_00264177 predicted 345
10 SASI_Rn01_00099417 predicted 358
11 SASI_Rn01_00099411 predicted 420
12 SASI_Rn01_00099415 predicted 838
13 SASI_Rn01_00099416 predicted 872
14 SASI_Rn01_00099418 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079415 predicted 704
2 SASI_Mm02_00326155 predicted 1016
3 SASI_Mm01_00079416 predicted 719
4 SASI_Mm02_00326156 predicted 795
5 SASI_Mm01_00079417 predicted 738
6 SASI_Mm02_00326157 predicted 968
7 SASI_Mm02_00326158 predicted 1074
8 SASI_Mm01_00079420 predicted 812
9 SASI_Mm01_00079421 predicted 1041
10 SASI_Mm01_00079422 predicted 350
11 SASI_Mm01_00079414 predicted 436
12 SASI_Mm01_00079418 predicted 621
13 SASI_Mm01_00079419 predicted 616
14 SASI_Mm01_00079423 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021473
VALIDATED
AKR1A1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1003s21c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1208s21c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1165s21c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-704s21c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021473.2-704s1c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1165s1c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1003s1c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-410s1c1
Sequence:CCGGGCAGCCATTAAACATGCCCTTCTCGAGAAGGGCATGTTTAATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1208s1c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021473
VALIDATED
AKR1A1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1003s21c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1208s21c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1165s21c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-704s21c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021473.2-704s1c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1165s1c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1003s1c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-410s1c1
Sequence:CCGGGCAGCCATTAAACATGCCCTTCTCGAGAAGGGCATGTTTAATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1208s1c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021473
VALIDATED
AKR1A1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1003s21c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1208s21c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-1165s21c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021473.2-704s21c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021473.2-704s1c1
Sequence:CCGGGCCGATGGAACTGTCAGATATCTCGAGATATCTGACAGTTCCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1165s1c1
Sequence:CCGGCCCAGAGGAGATGAAACAATTCTCGAGAATTGTTTCATCTCCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1003s1c1
Sequence:CCGGGCTTGAAGAACCAGTAGTCTTCTCGAGAAGACTACTGGTTCTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-410s1c1
Sequence:CCGGGCAGCCATTAAACATGCCCTTCTCGAGAAGGGCATGTTTAATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021473.2-1208s1c1
Sequence:CCGGCGGTATATTGTGCCCATGATTCTCGAGAATCATGGGCACAATATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153326
VALIDATED
AKR1A1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153326.1-427s21c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-453s21c1
Sequence:CCGGAGGCTACCGCCACATTGATTGCTCGAGCAATCAATGTGGCGGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-717s21c1
Sequence:CCGGGAATGCTGATGGGACTATATGCTCGAGCATATAGTCCCATCAGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-947s21c1
Sequence:CCGGGCCTGGAGGTAACTGCTTATACTCGAGTATAAGCAGTTACCTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-824s21c1
Sequence:CCGGACTTCAACAGTCGGCAGATTGCTCGAGCAATCTGCCGACTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-485s21c1
Sequence:CCGGACGGCAATGAGCCTGAGATTGCTCGAGCAATCTCAGGCTCATTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-1197s1c1
Sequence:CCGGGCAGCTAAATGCCCTGAACAACTCGAGTTGTTCAGGGCATTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-461s1c1
Sequence:CCGGGCCACATTGATTGTGCTGCTACTCGAGTAGCAGCACAATCAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-427s1c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-1146s1c1
Sequence:CCGGCCTTCAGAACATCAAGGTGTTCTCGAGAACACCTTGATGTTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-885s1c1
Sequence:CCGGGCAGGTGGAATGCCACCCATACTCGAGTATGGGTGGCATTCCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153326
VALIDATED
AKR1A1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153326.1-427s21c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-453s21c1
Sequence:CCGGAGGCTACCGCCACATTGATTGCTCGAGCAATCAATGTGGCGGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-717s21c1
Sequence:CCGGGAATGCTGATGGGACTATATGCTCGAGCATATAGTCCCATCAGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-947s21c1
Sequence:CCGGGCCTGGAGGTAACTGCTTATACTCGAGTATAAGCAGTTACCTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-824s21c1
Sequence:CCGGACTTCAACAGTCGGCAGATTGCTCGAGCAATCTGCCGACTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-485s21c1
Sequence:CCGGACGGCAATGAGCCTGAGATTGCTCGAGCAATCTCAGGCTCATTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-1197s1c1
Sequence:CCGGGCAGCTAAATGCCCTGAACAACTCGAGTTGTTCAGGGCATTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-461s1c1
Sequence:CCGGGCCACATTGATTGTGCTGCTACTCGAGTAGCAGCACAATCAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-427s1c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-1146s1c1
Sequence:CCGGCCTTCAGAACATCAAGGTGTTCTCGAGAACACCTTGATGTTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-885s1c1
Sequence:CCGGGCAGGTGGAATGCCACCCATACTCGAGTATGGGTGGCATTCCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153326
VALIDATED
AKR1A1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member A1 (aldehyde reductase)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153326.1-427s21c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-453s21c1
Sequence:CCGGAGGCTACCGCCACATTGATTGCTCGAGCAATCAATGTGGCGGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-717s21c1
Sequence:CCGGGAATGCTGATGGGACTATATGCTCGAGCATATAGTCCCATCAGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-947s21c1
Sequence:CCGGGCCTGGAGGTAACTGCTTATACTCGAGTATAAGCAGTTACCTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-824s21c1
Sequence:CCGGACTTCAACAGTCGGCAGATTGCTCGAGCAATCTGCCGACTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153326.1-485s21c1
Sequence:CCGGACGGCAATGAGCCTGAGATTGCTCGAGCAATCTCAGGCTCATTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-1197s1c1
Sequence:CCGGGCAGCTAAATGCCCTGAACAACTCGAGTTGTTCAGGGCATTTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-461s1c1
Sequence:CCGGGCCACATTGATTGTGCTGCTACTCGAGTAGCAGCACAATCAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153326.1-427s1c1
Sequence:CCGGGCAGCTGTTAAGTATGCCCTTCTCGAGAAGGGCATACTTAACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-1146s1c1
Sequence:CCGGCCTTCAGAACATCAAGGTGTTCTCGAGAACACCTTGATGTTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_153326.1-885s1c1
Sequence:CCGGGCAGGTGGAATGCCACCCATACTCGAGTATGGGTGGCATTCCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)