EMAIL THIS PAGE TO A FRIEND

AKR1B10

aldo-keto reductase family 1, member B10 (aldose reductase)

116 Gene Product Result for
Synonyms: AKR1B11 AKR1B12 ALDRLn ARL-1 ARL1 HIS HSI
UniProtKB ID: O60218, A4D1P1, O75890, Q6FHF3, Q8IWZ1
Gene ID:
Human(57016) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member can efficiently reduce aliphatic and aromatic aldehydes, and it is less active on hexoses. It is highly expressed in adrenal gland, small intestine, and colon, and may play an important role in liver carcinogenesis. [provided by RefSeq, Jul 2008]
Mouse(67861) aldo-keto reductase family 1, member B10 (aldose reductase)
Rat(296972) aldo-keto reductase family 1, member B10 (aldose reductase)
domestic guinea pig(100723118) aldo-keto reductase family 1, member B10 (aldose reductase)
naked mole-rat(101706493) aldo-keto reductase family 1, member B10 (aldose reductase)
sheep(101107697) aldo-keto reductase family 1, member B10 (aldose reductase)
Domestic Rabbit(100341518) aldo-keto reductase family 1, member B10 (aldose reductase)
chicken(395338) aldo-keto reductase family 1, member B10 (aldose reductase)
cow(525193) aldo-keto reductase family 1, member B10 (aldose reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020299 Rosetta Predictions human pricing
NM_001013084 Rosetta Predictions rat pricing
NM_172398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185939 predicted 640
2 SASI_Hs01_00185940 predicted 1236
3 SASI_Hs01_00185942 predicted 1229
4 SASI_Hs02_00353211 predicted 1216
5 SASI_Hs02_00353212 predicted 1211
6 SASI_Hs02_00353213 predicted 1310
7 SASI_Hs02_00353214 predicted 326
8 SASI_Hs02_00353215 predicted 370
9 SASI_Hs02_00353216 predicted 1294
10 SASI_Hs01_00185933 predicted 1080
11 SASI_Hs01_00185934 predicted 773
12 SASI_Hs01_00185935 predicted 1076
13 SASI_Hs01_00185936 predicted 1010
14 SASI_Hs01_00185937 predicted 813
15 SASI_Hs01_00185938 predicted 1022
16 SASI_Hs01_00185941 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048169 predicted 1064
2 SASI_Rn01_00048170 predicted 914
3 SASI_Rn01_00048171 predicted 507
4 SASI_Rn01_00048172 predicted 508
5 SASI_Rn01_00048174 predicted 875
6 SASI_Rn01_00048175 predicted 556
7 SASI_Rn01_00048176 predicted 971
8 SASI_Rn01_00048177 predicted 845
9 SASI_Rn01_00048178 predicted 1109
10 SASI_Rn02_00200722 predicted 853
11 SASI_Rn01_00048173 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114812 predicted 988
2 SASI_Mm01_00114813 predicted 432
3 SASI_Mm01_00114814 predicted 225
4 SASI_Mm01_00114815 predicted 700
5 SASI_Mm01_00114816 predicted 430
6 SASI_Mm01_00114817 predicted 428
7 SASI_Mm01_00114818 predicted 704
8 SASI_Mm01_00114819 predicted 770
9 SASI_Mm01_00114820 predicted 989
10 SASI_Mm01_00114821 predicted 892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172398
VALIDATED
AKR1B10 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member B10 (aldose reductase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1100s21c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-893s21c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1022s21c1
Sequence:CCGGCTTCCCTTTCCATGCGGAATACTCGAGTATTCCGCATGGAAAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-404s21c1
Sequence:CCGGCTACCTGGACCTGTATCTAATCTCGAGATTAGATACAGGTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172398.3-994s21c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172398.3-1100s1c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-893s1c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-994s1c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172398.3-216s1c1
Sequence:CCGGCGCCACATTGATTGTGCCTATCTCGAGATAGGCACAATCAATGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-491s1c1
Sequence:CCGGCAGCAGTAAATATACGTTCTTCTCGAGAAGAACGTATATTTACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172398
VALIDATED
AKR1B10 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member B10 (aldose reductase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1100s21c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-893s21c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1022s21c1
Sequence:CCGGCTTCCCTTTCCATGCGGAATACTCGAGTATTCCGCATGGAAAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-404s21c1
Sequence:CCGGCTACCTGGACCTGTATCTAATCTCGAGATTAGATACAGGTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172398.3-994s21c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172398.3-1100s1c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-893s1c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-994s1c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172398.3-216s1c1
Sequence:CCGGCGCCACATTGATTGTGCCTATCTCGAGATAGGCACAATCAATGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-491s1c1
Sequence:CCGGCAGCAGTAAATATACGTTCTTCTCGAGAAGAACGTATATTTACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172398
VALIDATED
AKR1B10 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member B10 (aldose reductase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1100s21c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-893s21c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-1022s21c1
Sequence:CCGGCTTCCCTTTCCATGCGGAATACTCGAGTATTCCGCATGGAAAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172398.3-404s21c1
Sequence:CCGGCTACCTGGACCTGTATCTAATCTCGAGATTAGATACAGGTCCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172398.3-994s21c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172398.3-1100s1c1
Sequence:CCGGCGCTCCTACTGACTCCTATTTCTCGAGAAATAGGAGTCAGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-893s1c1
Sequence:CCGGACCTTCTCGAATACAGGAGAACTCGAGTTCTCCTGTATTCGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-994s1c1
Sequence:CCGGGCCTGTTTGCAGCAAGTCATACTCGAGTATGACTTGCTGCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172398.3-216s1c1
Sequence:CCGGCGCCACATTGATTGTGCCTATCTCGAGATAGGCACAATCAATGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172398.3-491s1c1
Sequence:CCGGCAGCAGTAAATATACGTTCTTCTCGAGAAGAACGTATATTTACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020299
VALIDATED
AKR1B10 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member B10 (aldose reductase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-401s1c1
Sequence:CCGGGCCTATGTCTATCAGAATGAACTCGAGTTCATTCTGATAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020299.3-343s1c1
Sequence:CCGGCAAAGTGAAAGAAGCAGTGAACTCGAGTTCACTGCTTCTTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-956s1c1
Sequence:CCGGGATCCCAAGATTAAGGAGATTCTCGAGAATCTCCTTAATCTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1067s1c1
Sequence:CCGGGCACGCATTGTTGAGAACATTCTCGAGAATGTTCTCAACAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1165s1c1
Sequence:CCGGCGTGTTGCAATCCTCTCATTTCTCGAGAAATGAGAGGATTGCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020299
VALIDATED
AKR1B10 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member B10 (aldose reductase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-401s1c1
Sequence:CCGGGCCTATGTCTATCAGAATGAACTCGAGTTCATTCTGATAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020299.3-343s1c1
Sequence:CCGGCAAAGTGAAAGAAGCAGTGAACTCGAGTTCACTGCTTCTTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-956s1c1
Sequence:CCGGGATCCCAAGATTAAGGAGATTCTCGAGAATCTCCTTAATCTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1067s1c1
Sequence:CCGGGCACGCATTGTTGAGAACATTCTCGAGAATGTTCTCAACAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1165s1c1
Sequence:CCGGCGTGTTGCAATCCTCTCATTTCTCGAGAAATGAGAGGATTGCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020299
VALIDATED
AKR1B10 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member B10 (aldose reductase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-401s1c1
Sequence:CCGGGCCTATGTCTATCAGAATGAACTCGAGTTCATTCTGATAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020299.3-343s1c1
Sequence:CCGGCAAAGTGAAAGAAGCAGTGAACTCGAGTTCACTGCTTCTTTCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-956s1c1
Sequence:CCGGGATCCCAAGATTAAGGAGATTCTCGAGAATCTCCTTAATCTTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1067s1c1
Sequence:CCGGGCACGCATTGTTGAGAACATTCTCGAGAATGTTCTCAACAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020299.3-1165s1c1
Sequence:CCGGCGTGTTGCAATCCTCTCATTTCTCGAGAAATGAGAGGATTGCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks