EMAIL THIS PAGE TO A FRIEND

AKR1B15

aldo-keto reductase family 1, member B15

28 Gene Product Result for
Synonyms: AKR1B10L
Species: Human AKR1B15(441282)
UniProtKB ID: C9JRZ8, C9J3V2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080538 Rosetta Predictions human pricing
XM_496917 Rosetta Predictions human pricing
XM_930548 Rosetta Predictions human pricing
XM_935381 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315807 predicted 377
2 SASI_Hs02_00315808 predicted 469
3 SASI_Hs02_00315809 predicted 883
4 SASI_Hs02_00315810 predicted 112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262446 predicted 1227
2 SASI_Hs01_00262447 predicted 722
3 SASI_Hs01_00262448 predicted 727
4 SASI_Hs01_00262449 predicted 815
5 SASI_Hs01_00262450 predicted 1247
6 SASI_Hs01_00262451 predicted 450
7 SASI_Hs01_00262452 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294974 predicted 938
2 SASI_Hs01_00294975 predicted 425
3 SASI_Hs01_00294976 predicted 519
4 SASI_Hs01_00294977 predicted 152
5 SASI_Hs01_00294978 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261651 predicted 1099
2 SASI_Hs01_00261652 predicted 1384
3 SASI_Hs01_00261653 predicted 1148
4 SASI_Hs01_00261654 predicted 1383
5 SASI_Hs01_00261655 predicted 1174
6 SASI_Hs01_00261656 predicted 1184
7 SASI_Hs01_00261657 predicted 1175
8 SASI_Hs01_00261658 predicted 1170
9 SASI_Hs01_00261659 predicted 1097
10 SASI_Hs01_00261660 predicted 1398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080538
AKR1B15 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member B15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-650s21c1
Sequence:CCGGATAGACCTTGGGCCAAACCTGCTCGAGCAGGTTTGGCCCAAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-380s21c1
Sequence:CCGGATAAAGGTAATATGATCAGTGCTCGAGCACTGATCATATTACCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-63s21c1
Sequence:CCGGGAGGTCTCTTCTCGGCAAAGTCTCGAGACTTTGCCGAGAAGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-146s21c1
Sequence:CCGGATGAGAATCAACATGAGGTGGCTCGAGCCACCTCATGTTGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-134s21c1
Sequence:CCGGGTGCCTATTTCTATGAGAATCCTCGAGGATTCTCATAGAAATAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080538
AKR1B15 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member B15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-650s21c1
Sequence:CCGGATAGACCTTGGGCCAAACCTGCTCGAGCAGGTTTGGCCCAAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-380s21c1
Sequence:CCGGATAAAGGTAATATGATCAGTGCTCGAGCACTGATCATATTACCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-63s21c1
Sequence:CCGGGAGGTCTCTTCTCGGCAAAGTCTCGAGACTTTGCCGAGAAGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-146s21c1
Sequence:CCGGATGAGAATCAACATGAGGTGGCTCGAGCCACCTCATGTTGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-134s21c1
Sequence:CCGGGTGCCTATTTCTATGAGAATCCTCGAGGATTCTCATAGAAATAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080538
AKR1B15 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member B15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-650s21c1
Sequence:CCGGATAGACCTTGGGCCAAACCTGCTCGAGCAGGTTTGGCCCAAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-380s21c1
Sequence:CCGGATAAAGGTAATATGATCAGTGCTCGAGCACTGATCATATTACCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-63s21c1
Sequence:CCGGGAGGTCTCTTCTCGGCAAAGTCTCGAGACTTTGCCGAGAAGAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-146s21c1
Sequence:CCGGATGAGAATCAACATGAGGTGGCTCGAGCCACCTCATGTTGATTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080538.1-134s21c1
Sequence:CCGGGTGCCTATTTCTATGAGAATCCTCGAGGATTCTCATAGAAATAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks