EMAIL THIS PAGE TO A FRIEND

AKR1B1

aldo-keto reductase family 1, member B1 (aldose reductase)

70 Gene Product Result for
Synonyms: ADR ALDR1 ALR2 AR
Gene ID:
Human(231) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
Rat(24192) aldo-keto reductase family 1, member B1 (aldose reductase)
Zebrafish(415138) aldo-keto reductase family 1, member B1 (aldose reductase)
cow(317748) aldo-keto reductase family 1, member B1 (aldose reductase)
domestic cat(101095406) aldo-keto reductase family 1, member B1 (aldose reductase)
dog(607537) aldo-keto reductase family 1, member B1 (aldose reductase)
sheep(101120824) aldo-keto reductase family 1, member B1 (aldose reductase)
Domestic Rabbit(100009122) aldo-keto reductase family 1, member B1 (aldose reductase)
domestic guinea pig(100718017) aldo-keto reductase family 1, member B1 (aldose reductase)
naked mole-rat(101720124) aldo-keto reductase family 1, member B1 (aldose reductase)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409018 Anti-AKR1B1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV48180 Anti-AKR1B1 antibody produced in rabbit IgG fraction of antiserum canine, rabbit, rabbit, rat, bovine, mouse, pig, zebrafish, horse, human, guinea pig
western blot pricing
SAB2100091 Anti-AKR1B1 antibody produced in rabbit affinity isolated antibody bovine, horse, human, rabbit, mouse, rabbit, zebrafish, pig, rat, guinea pig, canine
western blot pricing
HPA026425 Anti-AKR1B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410404 Anti-AKR1B1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410405 Anti-AKR1B1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA052751 Anti-AKR1B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
SAB4500944 Anti-AKR1B1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat
ELISA, western blot pricing
SAB1402112 Monoclonal Anti-AKR1B1 antibody produced in mouse clone 2D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106951 MISSION® esiRNA esiRNA human AKR1B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001628 Rosetta Predictions human pricing
NM_012498 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140328 predicted 580
2 SASI_Hs01_00140329 predicted 281
3 SASI_Hs01_00140331 predicted 927
4 SASI_Hs01_00140332 predicted 469
5 SASI_Hs01_00140333 predicted 459
6 SASI_Hs01_00140334 predicted 444
7 SASI_Hs01_00140335 predicted 535
8 SASI_Hs01_00140336 predicted 634
9 SASI_Hs02_00332200 predicted 925
10 SASI_Hs02_00332201 predicted 636
11 SASI_Hs01_00140327 predicted 646
12 SASI_Hs01_00140330 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061264 predicted 461
2 SASI_Rn01_00061265 predicted 501
3 SASI_Rn01_00061268 predicted 980
4 SASI_Rn02_00259543 predicted 470
5 SASI_Rn02_00259544 predicted 838
6 SASI_Rn02_00259545 predicted 1221
7 SASI_Rn02_00259546 predicted 1273
8 SASI_Rn02_00259547 predicted 47
9 SASI_Rn01_00061262 predicted 1101
10 SASI_Rn01_00061263 predicted 1022
11 SASI_Rn01_00061266 predicted 1088
12 SASI_Rn01_00061267 predicted 1091
13 SASI_Rn01_00061269 predicted 1104
14 SASI_Rn01_00061270 predicted 1043
15 SASI_Rn01_00061271 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001628
VALIDATED
AKR1B1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member B1 (aldose reductase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-207s1c1
Sequence:CCGGTGTGCCCATGTGTACCAGAATCTCGAGATTCTGGTACACATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-444s1c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-884s1c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-569s1c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-468s1c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-569s21c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001628.2-444s21c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-468s21c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-884s21c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001628
VALIDATED
AKR1B1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member B1 (aldose reductase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-207s1c1
Sequence:CCGGTGTGCCCATGTGTACCAGAATCTCGAGATTCTGGTACACATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-444s1c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-884s1c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-569s1c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-468s1c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-569s21c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001628.2-444s21c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-468s21c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-884s21c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001628
VALIDATED
AKR1B1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member B1 (aldose reductase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-207s1c1
Sequence:CCGGTGTGCCCATGTGTACCAGAATCTCGAGATTCTGGTACACATGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-444s1c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-884s1c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-569s1c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001628.2-468s1c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-569s21c1
Sequence:CCGGCCAGGTGGAGATGATCTTAAACTCGAGTTTAAGATCATCTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001628.2-444s21c1
Sequence:CCGGCCATTGGATGAGTCGGGCAATCTCGAGATTGCCCGACTCATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-468s21c1
Sequence:CCGGGTTCCCAGTGACACCAACATTCTCGAGAATGTTGGTGTCACTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001628.2-884s21c1
Sequence:CCGGTGCTGAGAACTTTAAGGTCTTCTCGAGAAGACCTTAAAGTTCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks