EMAIL THIS PAGE TO A FRIEND

AKR1C1

aldo-keto reductase family 1, member C1

35 Gene Product Result for
Synonyms: 2-ALPHA-HSD 20-ALPHA-HSD C9 DD1 DD1/DD2 DDH DDH1 H-37 HAKRC HBAB MBAB
UniProtKB ID: Q04828, P52896, Q5SR15, Q7M4N2, Q9UCX2
Gene ID:
Human(1645) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reaction of progesterone to the inactive form 20-alpha-hydroxy-progesterone. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Rat(307092) aldo-keto reductase family 1, member C1
Horse(100034073) aldo-keto reductase family 1, member C1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001353 Rosetta Predictions human pricing
NM_001033697 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331683 predicted 1085
2 SASI_Hs02_00331684 predicted 765
3 SASI_Hs02_00331685 predicted 435
4 SASI_Hs02_00331686 predicted 1161
5 SASI_Hs02_00331687 predicted 1070
6 SASI_Hs01_00018724 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037318 predicted 817
2 SASI_Rn01_00037319 predicted 879
3 SASI_Rn01_00037322 predicted 587
4 SASI_Rn01_00037323 predicted 912
5 SASI_Rn01_00037324 predicted 364
6 SASI_Rn01_00037325 predicted 866
7 SASI_Rn01_00037326 predicted 683
8 SASI_Rn01_00037327 predicted 335
9 SASI_Rn02_00203727 predicted 577
10 SASI_Rn02_00203728 predicted 285
11 SASI_Rn01_00037320 predicted 615
12 SASI_Rn01_00037321 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001353
VALIDATED
AKR1C1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-128s1c1
Sequence:CCGGGCCACCAAATTGGCAATTGAACTCGAGTTCAATTGCCAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-928s1c1
Sequence:CCGGGCGATATTTGACCCTTGATATCTCGAGATATCAAGGGTCAAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-159s1c1
Sequence:CCGGGCCATATTGATTCTGCTCATTCTCGAGAATGAGCAGAATCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-467s1c1
Sequence:CCGGGCCGTGGAGAAGTGTAAAGATCTCGAGATCTTTACACTTCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-625s1c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-310s21c1
Sequence:CCGGGAAGCTGGCTTCCGCCATATTCTCGAGAATATGGCGGAAGCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-512s21c1
Sequence:CCGGATGTTGACCTCTACCTTATTCCTCGAGGAATAAGGTAGAGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-789s21c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-1206s21c1
Sequence:CCGGGACACAGAGGATGGCTCTATGCTCGAGCATAGAGCCATCCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-1078s21c1
Sequence:CCGGCTAAACAGAAATGTGCGATATCTCGAGATATCGCACATTTCTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001353
VALIDATED
AKR1C1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-128s1c1
Sequence:CCGGGCCACCAAATTGGCAATTGAACTCGAGTTCAATTGCCAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-928s1c1
Sequence:CCGGGCGATATTTGACCCTTGATATCTCGAGATATCAAGGGTCAAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-159s1c1
Sequence:CCGGGCCATATTGATTCTGCTCATTCTCGAGAATGAGCAGAATCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-467s1c1
Sequence:CCGGGCCGTGGAGAAGTGTAAAGATCTCGAGATCTTTACACTTCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-625s1c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-310s21c1
Sequence:CCGGGAAGCTGGCTTCCGCCATATTCTCGAGAATATGGCGGAAGCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-512s21c1
Sequence:CCGGATGTTGACCTCTACCTTATTCCTCGAGGAATAAGGTAGAGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-789s21c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-1206s21c1
Sequence:CCGGGACACAGAGGATGGCTCTATGCTCGAGCATAGAGCCATCCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-1078s21c1
Sequence:CCGGCTAAACAGAAATGTGCGATATCTCGAGATATCGCACATTTCTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001353
VALIDATED
AKR1C1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-128s1c1
Sequence:CCGGGCCACCAAATTGGCAATTGAACTCGAGTTCAATTGCCAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-928s1c1
Sequence:CCGGGCGATATTTGACCCTTGATATCTCGAGATATCAAGGGTCAAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-159s1c1
Sequence:CCGGGCCATATTGATTCTGCTCATTCTCGAGAATGAGCAGAATCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001353.4-467s1c1
Sequence:CCGGGCCGTGGAGAAGTGTAAAGATCTCGAGATCTTTACACTTCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001353.4-625s1c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-310s21c1
Sequence:CCGGGAAGCTGGCTTCCGCCATATTCTCGAGAATATGGCGGAAGCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-512s21c1
Sequence:CCGGATGTTGACCTCTACCTTATTCCTCGAGGAATAAGGTAGAGGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-789s21c1
Sequence:CCGGGCTGGATTTCTGCAAGTCAAACTCGAGTTTGACTTGCAGAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001353.5-1206s21c1
Sequence:CCGGGACACAGAGGATGGCTCTATGCTCGAGCATAGAGCCATCCTCTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001353.5-1078s21c1
Sequence:CCGGCTAAACAGAAATGTGCGATATCTCGAGATATCGCACATTTCTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks