EMAIL THIS PAGE TO A FRIEND

AKR1C2

aldo-keto reductase family 1, member C2

47 Gene Product Result for
Synonyms: AKR1C-pseudo BABP DD DD2 DDH2 HAKRD HBAB MCDR2 SRXY8
Gene ID:
Human(1646) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Rat(291283) aldo-keto reductase family 1, member C2
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001135241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001354 Rosetta Predictions human pricing
NM_205845 Rosetta Predictions human pricing
NM_001013057 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162436 predicted 1296
2 SASI_Hs01_00162437 predicted 639
3 SASI_Hs01_00162438 predicted 972
4 SASI_Hs01_00162439 predicted 648
5 SASI_Hs01_00162440 predicted 489
6 SASI_Hs01_00162441 predicted 1286
7 SASI_Hs01_00162442 predicted 530
8 SASI_Hs01_00162443 predicted 536
9 SASI_Hs01_00162444 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185918 predicted 392
2 SASI_Hs01_00185921 predicted 437
3 SASI_Hs01_00185914 predicted 1207
4 SASI_Hs01_00185915 predicted 536
5 SASI_Hs01_00185916 predicted 876
6 SASI_Hs01_00185917 predicted 552
7 SASI_Hs01_00185919 predicted 1192
8 SASI_Hs01_00185920 predicted 433
9 SASI_Hs01_00185922 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084198 predicted 818
2 SASI_Rn01_00084199 predicted 476
3 SASI_Rn01_00084200 predicted 816
4 SASI_Rn01_00084201 predicted 201
5 SASI_Rn01_00084202 predicted 989
6 SASI_Rn01_00084203 predicted 1012
7 SASI_Rn01_00084204 predicted 596
8 SASI_Rn01_00084205 predicted 951
9 SASI_Rn01_00084206 predicted 223
10 SASI_Rn01_00084207 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001354
VALIDATED
AKR1C2 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-962s1c1
Sequence:CCGGCCAGGTGGAATGTCATCCTTACTCGAGTAAGGATGACATTCCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-504s1c1
Sequence:CCGGGCCGTCAAATTGGCAATAGAACTCGAGTTCTATTGCCAATTTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-543s1c1
Sequence:CCGGGATTCTGCACATGTTTACAATCTCGAGATTGTAAACATGTGCAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-1253s1c1
Sequence:CCGGCCAGTTGACTTCAGAGGAGATCTCGAGATCTCCTCTGAAGTCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-687s1c1
Sequence:CCGGGCCTTGGAAAGGTCACTGAAACTCGAGTTTCAGTGACCTTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-724s21c1
Sequence:CCGGATGTTGACCTCTATCTTATTCCTCGAGGAATAAGATAGAGGTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-494s21c1
Sequence:CCGGAGCTCTAGAGGCCGTCAAATTCTCGAGAATTTGACGGCCTCTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1024s21c1
Sequence:CCGGACATTGTTCTGGTTGCCTATACTCGAGTATAGGCAACCAGAACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1291s21c1
Sequence:CCGGTAAACAGAAATGTGCGATATTCTCGAGAATATCGCACATTTCTGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1476s21c1
Sequence:CCGGCTGCTTGGCGACTTCAGTAAGCTCGAGCTTACTGAAGTCGCCAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001354
VALIDATED
AKR1C2 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-962s1c1
Sequence:CCGGCCAGGTGGAATGTCATCCTTACTCGAGTAAGGATGACATTCCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-504s1c1
Sequence:CCGGGCCGTCAAATTGGCAATAGAACTCGAGTTCTATTGCCAATTTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-543s1c1
Sequence:CCGGGATTCTGCACATGTTTACAATCTCGAGATTGTAAACATGTGCAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-1253s1c1
Sequence:CCGGCCAGTTGACTTCAGAGGAGATCTCGAGATCTCCTCTGAAGTCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-687s1c1
Sequence:CCGGGCCTTGGAAAGGTCACTGAAACTCGAGTTTCAGTGACCTTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-724s21c1
Sequence:CCGGATGTTGACCTCTATCTTATTCCTCGAGGAATAAGATAGAGGTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-494s21c1
Sequence:CCGGAGCTCTAGAGGCCGTCAAATTCTCGAGAATTTGACGGCCTCTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1024s21c1
Sequence:CCGGACATTGTTCTGGTTGCCTATACTCGAGTATAGGCAACCAGAACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1291s21c1
Sequence:CCGGTAAACAGAAATGTGCGATATTCTCGAGAATATCGCACATTTCTGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1476s21c1
Sequence:CCGGCTGCTTGGCGACTTCAGTAAGCTCGAGCTTACTGAAGTCGCCAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001354
VALIDATED
AKR1C2 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-962s1c1
Sequence:CCGGCCAGGTGGAATGTCATCCTTACTCGAGTAAGGATGACATTCCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-504s1c1
Sequence:CCGGGCCGTCAAATTGGCAATAGAACTCGAGTTCTATTGCCAATTTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001354.4-543s1c1
Sequence:CCGGGATTCTGCACATGTTTACAATCTCGAGATTGTAAACATGTGCAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-1253s1c1
Sequence:CCGGCCAGTTGACTTCAGAGGAGATCTCGAGATCTCCTCTGAAGTCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001354.4-687s1c1
Sequence:CCGGGCCTTGGAAAGGTCACTGAAACTCGAGTTTCAGTGACCTTTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-724s21c1
Sequence:CCGGATGTTGACCTCTATCTTATTCCTCGAGGAATAAGATAGAGGTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-494s21c1
Sequence:CCGGAGCTCTAGAGGCCGTCAAATTCTCGAGAATTTGACGGCCTCTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1024s21c1
Sequence:CCGGACATTGTTCTGGTTGCCTATACTCGAGTATAGGCAACCAGAACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1291s21c1
Sequence:CCGGTAAACAGAAATGTGCGATATTCTCGAGAATATCGCACATTTCTGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001354.4-1476s21c1
Sequence:CCGGCTGCTTGGCGACTTCAGTAAGCTCGAGCTTACTGAAGTCGCCAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135241
AKR1C2 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135241.1-574s21c1
Sequence:CCGGTGAAGGCACAAGGTCTTATTTCTCGAGAAATAAGACCTTGTGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-415s21c1
Sequence:CCGGCATGGAAGAAGAGCCCTAAACCTCGAGGTTTAGGGCTCTTCTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-391s21c1
Sequence:CCGGTAAAGGAGGACATAGGGATTTCTCGAGAAATCCCTATGTCCTCCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-442s21c1
Sequence:CCGGCCTAATTCCTTTCTATGGAACCTCGAGGTTCCATAGAAAGGAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-428s21c1
Sequence:CCGGCCCTAAACATAACTCCTAATTCTCGAGAATTAGGAGTTATGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135241
AKR1C2 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135241.1-574s21c1
Sequence:CCGGTGAAGGCACAAGGTCTTATTTCTCGAGAAATAAGACCTTGTGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-415s21c1
Sequence:CCGGCATGGAAGAAGAGCCCTAAACCTCGAGGTTTAGGGCTCTTCTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-391s21c1
Sequence:CCGGTAAAGGAGGACATAGGGATTTCTCGAGAAATCCCTATGTCCTCCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-442s21c1
Sequence:CCGGCCTAATTCCTTTCTATGGAACCTCGAGGTTCCATAGAAAGGAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-428s21c1
Sequence:CCGGCCCTAAACATAACTCCTAATTCTCGAGAATTAGGAGTTATGTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135241
AKR1C2 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135241.1-574s21c1
Sequence:CCGGTGAAGGCACAAGGTCTTATTTCTCGAGAAATAAGACCTTGTGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-415s21c1
Sequence:CCGGCATGGAAGAAGAGCCCTAAACCTCGAGGTTTAGGGCTCTTCTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-391s21c1
Sequence:CCGGTAAAGGAGGACATAGGGATTTCTCGAGAAATCCCTATGTCCTCCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-442s21c1
Sequence:CCGGCCTAATTCCTTTCTATGGAACCTCGAGGTTCCATAGAAAGGAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135241.1-428s21c1
Sequence:CCGGCCCTAAACATAACTCCTAATTCTCGAGAATTAGGAGTTATGTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)