EMAIL THIS PAGE TO A FRIEND

AKR1C3

aldo-keto reductase family 1, member C3

34 Gene Product Result for
Synonyms: DD3 DDX HA1753 HAKRB HAKRe HSD17B5 PGFS hluPGFS
Gene ID:
Human(8644) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Rat(171516) aldo-keto reductase family 1, member C3
dog(497070) aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
cow(782884) aldo-keto reductase family 1, member C1
cow(617917) aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
domestic cat(100510801) aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003739 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104541 MISSION® esiRNA esiRNA human AKR1C3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003739 Rosetta Predictions human pricing
NM_138510 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116089 predicted 406
2 SASI_Hs01_00116090 predicted 653
3 SASI_Hs01_00116091 predicted 443
4 SASI_Hs01_00116092 predicted 647
5 SASI_Hs01_00116093 predicted 659
6 SASI_Hs01_00116094 predicted 667
7 SASI_Hs01_00116095 predicted 648
8 SASI_Hs01_00116096 predicted 438
9 SASI_Hs01_00116097 predicted 925
10 SASI_Hs01_00116098 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033294 predicted 876
2 SASI_Rn01_00033295 predicted 387
3 SASI_Rn01_00033296 predicted 834
4 SASI_Rn01_00033297 predicted 706
5 SASI_Rn01_00033298 predicted 425
6 SASI_Rn01_00033299 predicted 350
7 SASI_Rn01_00033300 predicted 226
8 SASI_Rn01_00033301 predicted 939
9 SASI_Rn01_00033302 predicted 700
10 SASI_Rn01_00033303 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003739
VALIDATED
AKR1C3 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-148s1c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003739.4-652s1c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-963s1c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-372s1c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-663s1c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-652s21c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-148s21c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-963s21c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-663s21c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-372s21c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003739
VALIDATED
AKR1C3 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-148s1c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003739.4-652s1c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-963s1c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-372s1c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-663s1c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-652s21c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-148s21c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-963s21c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-663s21c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-372s21c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003739
VALIDATED
AKR1C3 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-148s1c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003739.4-652s1c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-963s1c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-372s1c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003739.4-663s1c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-652s21c1
Sequence:CCGGCCGTATTTCAACCGGAGTAAACTCGAGTTTACTCCGGTTGAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-148s21c1
Sequence:CCGGCCAGAGGTTCCGAGAAGTAAACTCGAGTTTACTTCTCGGAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-963s21c1
Sequence:CCGGCCTAGACAGAAATCTCCACTACTCGAGTAGTGGAGATTTCTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-663s21c1
Sequence:CCGGCCGGAGTAAATTGCTAGATTTCTCGAGAAATCTAGCAATTTACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003739.4-372s21c1
Sequence:CCGGCTCACTGAAGAAAGCTCAATTCTCGAGAATTGAGCTTTCTTCAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks