EMAIL THIS PAGE TO A FRIEND

AKR1C4

aldo-keto reductase family 1, member C4

Synonyms: 3-alpha-HSD C11 CDR CHDR DD-4 DD4 HAKRA
UniProtKB ID: P17516, Q5T6A3, Q8WW84, Q9NS54
Gene ID:
Human(1109) Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
cow(282138) aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)
Gene Class: Dehydrogenase
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001818 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127441 MISSION® esiRNA esiRNA human AKR1C4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001818 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115589 predicted 967
2 SASI_Hs01_00115590 predicted 968
3 SASI_Hs01_00115591 predicted 887
4 SASI_Hs01_00115592 predicted 395
5 SASI_Hs01_00115594 predicted 902
6 SASI_Hs01_00115595 predicted 936
7 SASI_Hs01_00115596 predicted 396
8 SASI_Hs01_00115598 predicted 699
9 SASI_Hs01_00115593 predicted 744
10 SASI_Hs02_00332602 predicted 755
11 SASI_Hs01_00115597 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001818
AKR1C4 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-912s21c1
Sequence:CCGGGAAAGTTCTAGATGGTCTAAACTCGAGTTTAGACCATCTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-447s21c1
Sequence:CCGGATTCGACACAGTGGATCTCTCCTCGAGGAGAGATCCACTGTGTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-855s1c1
Sequence:CCGGGCAGCGGATCAGAGAGAACATCTCGAGATGTTCTCTCTGATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-970s1c1
Sequence:CCGGGACCATCCTGATTATCCATTTCTCGAGAAATGGATAATCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-692s1c1
Sequence:CCGGGAACCCAACGACATAAACTATCTCGAGATAGTTTATGTCGTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-133s1c1
Sequence:CCGGGCTGTAGAGGTCACCAAATTACTCGAGTAATTTGGTGACCTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-172s1c1
Sequence:CCGGCGCCATATTGATTCTGCTTATCTCGAGATAAGCAGAATCAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001818
AKR1C4 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-912s21c1
Sequence:CCGGGAAAGTTCTAGATGGTCTAAACTCGAGTTTAGACCATCTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-447s21c1
Sequence:CCGGATTCGACACAGTGGATCTCTCCTCGAGGAGAGATCCACTGTGTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-855s1c1
Sequence:CCGGGCAGCGGATCAGAGAGAACATCTCGAGATGTTCTCTCTGATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-970s1c1
Sequence:CCGGGACCATCCTGATTATCCATTTCTCGAGAAATGGATAATCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-692s1c1
Sequence:CCGGGAACCCAACGACATAAACTATCTCGAGATAGTTTATGTCGTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-133s1c1
Sequence:CCGGGCTGTAGAGGTCACCAAATTACTCGAGTAATTTGGTGACCTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-172s1c1
Sequence:CCGGCGCCATATTGATTCTGCTTATCTCGAGATAAGCAGAATCAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001818
AKR1C4 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-912s21c1
Sequence:CCGGGAAAGTTCTAGATGGTCTAAACTCGAGTTTAGACCATCTAGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001818.2-447s21c1
Sequence:CCGGATTCGACACAGTGGATCTCTCCTCGAGGAGAGATCCACTGTGTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-855s1c1
Sequence:CCGGGCAGCGGATCAGAGAGAACATCTCGAGATGTTCTCTCTGATCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-970s1c1
Sequence:CCGGGACCATCCTGATTATCCATTTCTCGAGAAATGGATAATCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-692s1c1
Sequence:CCGGGAACCCAACGACATAAACTATCTCGAGATAGTTTATGTCGTTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-133s1c1
Sequence:CCGGGCTGTAGAGGTCACCAAATTACTCGAGTAATTTGGTGACCTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001818.2-172s1c1
Sequence:CCGGCGCCATATTGATTCTGCTTATCTCGAGATAAGCAGAATCAATATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks