EMAIL THIS PAGE TO A FRIEND

AKR1C6P

aldo-keto reductase family 1, member C6, pseudogene

43 Gene Product Result for
Synonyms: TAKR
Species: Human AKR1C6P(389932)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715222 Rosetta Predictions human pricing
XM_372302 Rosetta Predictions human pricing
XM_937939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402252 predicted 441
2 SASI_Hs02_00402253 predicted 384
3 SASI_Hs02_00402254 predicted 761
4 SASI_Hs02_00402255 predicted 656
5 SASI_Hs02_00402256 predicted 423
6 SASI_Hs02_00402257 predicted 654
7 SASI_Hs02_00402258 predicted 670
8 SASI_Hs02_00402259 predicted 451
9 SASI_Hs02_00402260 predicted 415
10 SASI_Hs02_00402261 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479378 predicted 419
2 SASI_Hs02_00479379 predicted 383
3 SASI_Hs02_00479380 predicted 436
4 SASI_Hs02_00479381 predicted 414
5 SASI_Hs02_00479382 predicted 448
6 SASI_Hs01_00266616 predicted 318
7 SASI_Hs02_00479383 predicted 317
8 SASI_Hs02_00479384 predicted 369
9 SASI_Hs02_00479385 predicted 446
10 SASI_Hs02_00479386 predicted 348
11 SASI_Hs01_00266608 predicted 236
12 SASI_Hs01_00266609 predicted 380
13 SASI_Hs01_00266610 predicted 677
14 SASI_Hs01_00266611 predicted 420
15 SASI_Hs01_00266612 predicted 408
16 SASI_Hs01_00266613 predicted 354
17 SASI_Hs01_00266614 predicted 588
18 SASI_Hs01_00266615 predicted 359
19 SASI_Hs01_00266617 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482780 predicted 439
2 SASI_Hs02_00482781 predicted 380
3 SASI_Hs02_00482782 predicted 764
4 SASI_Hs02_00482783 predicted 652
5 SASI_Hs02_00482784 predicted 506
6 SASI_Hs02_00482785 predicted 495
7 SASI_Hs02_00482786 predicted 425
8 SASI_Hs02_00482787 predicted 655
9 SASI_Hs02_00482788 predicted 670
10 SASI_Hs02_00482789 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372302
AKR1C6P MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C6, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-348s1c1
Sequence:CCGGGCTGAGCTACATGGATCTTTACTCGAGTAAAGATCCATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-55s1c1
Sequence:CCGGCCTGGTGAAGAATGTTATAAACTCGAGTTTATAACATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-583s1c1
Sequence:CCGGGCACAGGGAAAGATCATGTTTCTCGAGAAACATGATCTTTCCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-167s1c1
Sequence:CCGGGCCATATTGACTCAGCTTATACTCGAGTATAAGCTGAGTCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-115s1c1
Sequence:CCGGGCTATGAGTAATGTAGAAGAACTCGAGTTCTTCTACATTACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372302
AKR1C6P MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C6, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-348s1c1
Sequence:CCGGGCTGAGCTACATGGATCTTTACTCGAGTAAAGATCCATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-55s1c1
Sequence:CCGGCCTGGTGAAGAATGTTATAAACTCGAGTTTATAACATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-583s1c1
Sequence:CCGGGCACAGGGAAAGATCATGTTTCTCGAGAAACATGATCTTTCCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-167s1c1
Sequence:CCGGGCCATATTGACTCAGCTTATACTCGAGTATAAGCTGAGTCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-115s1c1
Sequence:CCGGGCTATGAGTAATGTAGAAGAACTCGAGTTCTTCTACATTACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372302
AKR1C6P MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C6, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-348s1c1
Sequence:CCGGGCTGAGCTACATGGATCTTTACTCGAGTAAAGATCCATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-55s1c1
Sequence:CCGGCCTGGTGAAGAATGTTATAAACTCGAGTTTATAACATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-583s1c1
Sequence:CCGGGCACAGGGAAAGATCATGTTTCTCGAGAAACATGATCTTTCCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-167s1c1
Sequence:CCGGGCCATATTGACTCAGCTTATACTCGAGTATAAGCTGAGTCAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372302.1-115s1c1
Sequence:CCGGGCTATGAGTAATGTAGAAGAACTCGAGTTCTTCTACATTACTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks