EMAIL THIS PAGE TO A FRIEND

AKR1CL1

aldo-keto reductase family 1, member C-like 1

Species: Human AKR1CL1(340811)
UniProtKB ID: Q5T2L2, A6NF66, Q6ZN81
Gene ID:
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007536 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098153 predicted 211
2 SASI_Hs02_00305325 predicted 214
3 SASI_Hs02_00305326 predicted 263
4 SASI_Hs02_00305327 predicted 260
5 SASI_Hs01_00098157 predicted 224
6 SASI_Hs02_00305328 predicted 216
7 SASI_Hs02_00305329 predicted 226
8 SASI_Hs02_00305330 predicted 266
9 SASI_Hs02_00305331 predicted 258
10 SASI_Hs02_00305332 predicted 224
11 SASI_Hs01_00098152 predicted 514
12 SASI_Hs01_00098154 predicted 487
13 SASI_Hs01_00098155 predicted 350
14 SASI_Hs01_00098156 predicted 290
15 SASI_Hs01_00098158 predicted 391
16 SASI_Hs01_00098159 predicted 206
17 SASI_Hs01_00098160 predicted 861
18 SASI_Hs01_00098161 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291723
AKR1CL1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member C-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-265s1c1
Sequence:CCGGGCTACTTTCTTTCGGGCAGAACTCGAGTTCTGCCCGAAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-71s1c1
Sequence:CCGGGCACTTATGCTCCTGATCATACTCGAGTATGATCAGGAGCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-377s1c1
Sequence:CCGGCTGGGAAAGAATTACTGCCAACTCGAGTTGGCAGTAATTCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-673s1c1
Sequence:CCGGGAGCCGATCTTGAAATCCATTCTCGAGAATGGATTTCAAGATCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-147s1c1
Sequence:CCGGCCATATTGATTCAGCATACTTCTCGAGAAGTATGCTGAATCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291723
AKR1CL1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member C-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-265s1c1
Sequence:CCGGGCTACTTTCTTTCGGGCAGAACTCGAGTTCTGCCCGAAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-71s1c1
Sequence:CCGGGCACTTATGCTCCTGATCATACTCGAGTATGATCAGGAGCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-377s1c1
Sequence:CCGGCTGGGAAAGAATTACTGCCAACTCGAGTTGGCAGTAATTCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-673s1c1
Sequence:CCGGGAGCCGATCTTGAAATCCATTCTCGAGAATGGATTTCAAGATCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-147s1c1
Sequence:CCGGCCATATTGATTCAGCATACTTCTCGAGAAGTATGCTGAATCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291723
AKR1CL1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member C-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-265s1c1
Sequence:CCGGGCTACTTTCTTTCGGGCAGAACTCGAGTTCTGCCCGAAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-71s1c1
Sequence:CCGGGCACTTATGCTCCTGATCATACTCGAGTATGATCAGGAGCATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-377s1c1
Sequence:CCGGCTGGGAAAGAATTACTGCCAACTCGAGTTGGCAGTAATTCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-673s1c1
Sequence:CCGGGAGCCGATCTTGAAATCCATTCTCGAGAATGGATTTCAAGATCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291723.3-147s1c1
Sequence:CCGGCCATATTGATTCAGCATACTTCTCGAGAAGTATGCTGAATCAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks