EMAIL THIS PAGE TO A FRIEND

AKR1D1

aldo-keto reductase family 1, member D1

75 Gene Product Result for
Synonyms: 3o5bred CBAS2 SRD5B1
UniProtKB ID: P51857, A1L4P6, A8K060, B4DPN3, B4DPN8
Gene ID:
Human(6718) Summary: The enzyme encoded by this gene is responsible for the catalysis of the 5-beta-reduction of bile acid intermediates and steroid hormones carrying a delta(4)-3-one structure. Deficiency of this enzyme may contribute to hepatic dysfunction. Three transcript variants encoding different isoforms have been found for this gene. Other variants may be present, but their full-length natures have not been determined yet. [provided by RefSeq, Jul 2010]
Mouse(208665) aldo-keto reductase family 1, member D1
Rat(192242) aldo-keto reductase family 1, member D1
chicken(418107) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
dog(482711) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
dog(491379) 3-oxo-5-beta-steroid 4-dehydrogenase-like
domestic cat(101100551) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
cow(513855) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
domestic guinea pig(100713034) aldo-keto reductase family 1, member D1
naked mole-rat(101716388) aldo-keto reductase family 1, member D1
sheep(101103641) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
Domestic Rabbit(100008612) aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005989 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005989 Rosetta Predictions human pricing
NM_138884 Rosetta Predictions rat pricing
XM_579660 Rosetta Predictions rat pricing
NM_145364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158364 predicted 745
2 SASI_Hs02_00340680 predicted 311
3 SASI_Hs01_00158366 predicted 465
4 SASI_Hs02_00340681 predicted 289
5 SASI_Hs01_00158369 predicted 330
6 SASI_Hs02_00340682 predicted 738
7 SASI_Hs01_00158370 predicted 780
8 SASI_Hs02_00340683 predicted 340
9 SASI_Hs01_00158373 predicted 615
10 SASI_Hs02_00340684 predicted 951
11 SASI_Hs01_00158365 predicted 657
12 SASI_Hs01_00158367 predicted 487
13 SASI_Hs01_00158368 predicted 1010
14 SASI_Hs01_00158371 predicted 483
15 SASI_Hs01_00158372 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086959 predicted 192
2 SASI_Rn01_00086960 predicted 352
3 SASI_Rn01_00086961 predicted 705
4 SASI_Rn01_00086962 predicted 802
5 SASI_Rn01_00086963 predicted 365
6 SASI_Rn01_00086964 predicted 784
7 SASI_Rn01_00086965 predicted 712
8 SASI_Rn02_00268317 predicted 200
9 SASI_Rn01_00086966 predicted 450
10 SASI_Rn01_00086967 predicted 674
11 SASI_Rn01_00086968 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171259 predicted 364
2 SASI_Rn01_00171260 predicted 709
3 SASI_Rn01_00171261 predicted 809
4 SASI_Rn01_00171262 predicted 199
5 SASI_Rn01_00171263 predicted 370
6 SASI_Rn01_00171264 predicted 793
7 SASI_Rn01_00171265 predicted 720
8 SASI_Rn01_00171266 predicted 459
9 SASI_Rn01_00171267 predicted 301
10 SASI_Rn01_00171268 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340635 predicted 658
2 SASI_Mm02_00340636 predicted 1291
3 SASI_Mm02_00340637 predicted 381
4 SASI_Mm02_00340638 predicted 476
5 SASI_Mm02_00340639 predicted 446
6 SASI_Mm02_00340640 predicted 278
7 SASI_Mm02_00340641 predicted 661
8 SASI_Mm02_00340642 predicted 814
9 SASI_Mm02_00340643 predicted 742
10 SASI_Mm02_00340644 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005989
AKR1D1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member D1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-778s1c1
Sequence:CCGGCCTTTGTTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-987s1c1
Sequence:CCGGCCGCTTTGTAGAATTGCTCATCTCGAGATGAGCAATTCTACAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-397s1c1
Sequence:CCGGCAGCTAGATTATGTGGATCTTCTCGAGAAGATCCACATAATCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-465s1c1
Sequence:CCGGCCCTAGAGATGAGAATGGCAACTCGAGTTGCCATTCTCATCTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-1013s1c1
Sequence:CCGGGCGATCATCCTGAATACCCATCTCGAGATGGGTATTCAGGATGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-893s21c1
Sequence:CCGGTTAATCTTGAAAGGATCAAAGCTCGAGCTTTGATCCTTTCAAGATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-184s21c1
Sequence:CCGGACATCGGTGAAGGTTGCTATTCTCGAGAATAGCAACCTTCACCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005989
AKR1D1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member D1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-778s1c1
Sequence:CCGGCCTTTGTTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-987s1c1
Sequence:CCGGCCGCTTTGTAGAATTGCTCATCTCGAGATGAGCAATTCTACAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-397s1c1
Sequence:CCGGCAGCTAGATTATGTGGATCTTCTCGAGAAGATCCACATAATCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-465s1c1
Sequence:CCGGCCCTAGAGATGAGAATGGCAACTCGAGTTGCCATTCTCATCTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-1013s1c1
Sequence:CCGGGCGATCATCCTGAATACCCATCTCGAGATGGGTATTCAGGATGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-893s21c1
Sequence:CCGGTTAATCTTGAAAGGATCAAAGCTCGAGCTTTGATCCTTTCAAGATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-184s21c1
Sequence:CCGGACATCGGTGAAGGTTGCTATTCTCGAGAATAGCAACCTTCACCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005989
AKR1D1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member D1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-778s1c1
Sequence:CCGGCCTTTGTTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-987s1c1
Sequence:CCGGCCGCTTTGTAGAATTGCTCATCTCGAGATGAGCAATTCTACAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-397s1c1
Sequence:CCGGCAGCTAGATTATGTGGATCTTCTCGAGAAGATCCACATAATCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-465s1c1
Sequence:CCGGCCCTAGAGATGAGAATGGCAACTCGAGTTGCCATTCTCATCTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005989.1-1013s1c1
Sequence:CCGGGCGATCATCCTGAATACCCATCTCGAGATGGGTATTCAGGATGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-893s21c1
Sequence:CCGGTTAATCTTGAAAGGATCAAAGCTCGAGCTTTGATCCTTTCAAGATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005989.2-184s21c1
Sequence:CCGGACATCGGTGAAGGTTGCTATTCTCGAGAATAGCAACCTTCACCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145364
AKR1D1 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-105s1c1
Sequence:CCGGCCTAAGTGATGGGAACAACATCTCGAGATGTTGTTCCCATCACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-775s1c1
Sequence:CCGGCCACCCTTGTTAAATGACGAACTCGAGTTCGTCATTTAACAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-1018s1c1
Sequence:CCGGCATCCTGAATACCCATTTCATCTCGAGATGAAATGGGTATTCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-660s1c1
Sequence:CCGGCCCGTATTTCACCCAGACAAACTCGAGTTTGTCTGGGTGAAATACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-391s1c1
Sequence:CCGGGCCCTCAAACTAGATTACATACTCGAGTATGTAATCTAGTTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145364
AKR1D1 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-105s1c1
Sequence:CCGGCCTAAGTGATGGGAACAACATCTCGAGATGTTGTTCCCATCACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-775s1c1
Sequence:CCGGCCACCCTTGTTAAATGACGAACTCGAGTTCGTCATTTAACAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-1018s1c1
Sequence:CCGGCATCCTGAATACCCATTTCATCTCGAGATGAAATGGGTATTCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-660s1c1
Sequence:CCGGCCCGTATTTCACCCAGACAAACTCGAGTTTGTCTGGGTGAAATACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-391s1c1
Sequence:CCGGGCCCTCAAACTAGATTACATACTCGAGTATGTAATCTAGTTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145364
AKR1D1 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-105s1c1
Sequence:CCGGCCTAAGTGATGGGAACAACATCTCGAGATGTTGTTCCCATCACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-775s1c1
Sequence:CCGGCCACCCTTGTTAAATGACGAACTCGAGTTCGTCATTTAACAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-1018s1c1
Sequence:CCGGCATCCTGAATACCCATTTCATCTCGAGATGAAATGGGTATTCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-660s1c1
Sequence:CCGGCCCGTATTTCACCCAGACAAACTCGAGTTTGTCTGGGTGAAATACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145364.1-391s1c1
Sequence:CCGGGCCCTCAAACTAGATTACATACTCGAGTATGTAATCTAGTTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)