EMAIL THIS PAGE TO A FRIEND

AKR1E2

aldo-keto reductase family 1, member E2

41 Gene Product Result for
Synonyms: AKR1CL2 AKRDC1 LoopADR hTSP htAKR
UniProtKB ID: Q96JD6, Q86Z16, Q86Z17, Q86Z18, Q9BU71
Gene ID:
Human(83592) Summary: The protein encoded by this gene is a member of the aldo-keto reductase superfamily. Members in this family are characterized by their structure (evolutionarily highly conserved TIM barrel) and function (NAD(P)H-dependent oxido-reduction of carbonyl groups). Transcripts of this gene have been reported in specimens of human testis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Rat(307091) aldo-keto reductase family 1, member E2
sheep(101110956) aldo-keto reductase family 1, member E2
dog(608809) aldo-keto reductase family 1, member E2
domestic cat(101097814) aldo-keto reductase family 1, member E2
cow(615959) aldo-keto reductase family 1, member E2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040177 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123951 MISSION® esiRNA esiRNA human AKR1CL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040177 Rosetta Predictions human pricing
NM_001008342 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216733 predicted 585
2 SASI_Hs01_00216734 predicted 980
3 SASI_Hs01_00216735 predicted 380
4 SASI_Hs01_00216736 predicted 846
5 SASI_Hs02_00308881 predicted 709
6 SASI_Hs01_00216737 predicted 365
7 SASI_Hs01_00216738 predicted 1047
8 SASI_Hs01_00216739 predicted 672
9 SASI_Hs01_00216740 predicted 347
10 SASI_Hs01_00216741 predicted 998
11 SASI_Hs01_00216742 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102569 predicted 590
2 SASI_Rn01_00102570 predicted 945
3 SASI_Rn01_00102571 predicted 484
4 SASI_Rn01_00102572 predicted 698
5 SASI_Rn01_00102573 predicted 526
6 SASI_Rn01_00102574 predicted 395
7 SASI_Rn02_00199093 predicted 882
8 SASI_Rn01_00102575 predicted 547
9 SASI_Rn01_00102576 predicted 710
10 SASI_Rn01_00102577 predicted 825
11 SASI_Rn01_00102578 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031436
VALIDATED
AKR1E2 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-596s1c1
Sequence:CCGGGTGTCAAACTTCAACCATGAACTCGAGTTCATGGTTGAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-901s1c1
Sequence:CCGGCCCAAGTCACATTAAAGAGAACTCGAGTTCTCTTTAATGTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031436.2-367s1c1
Sequence:CCGGGCTGAACTATTTGGACCTCTACTCGAGTAGAGGTCCAAATAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031436.2-784s1c1
Sequence:CCGGCCTGATAGACAACCCTGTGATCTCGAGATCACAGGGTTGTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-307s1c1
Sequence:CCGGCACCTGCCATAAGAAGTCCTTCTCGAGAAGGACTTCTTATGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031436
VALIDATED
AKR1E2 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-596s1c1
Sequence:CCGGGTGTCAAACTTCAACCATGAACTCGAGTTCATGGTTGAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-901s1c1
Sequence:CCGGCCCAAGTCACATTAAAGAGAACTCGAGTTCTCTTTAATGTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031436.2-367s1c1
Sequence:CCGGGCTGAACTATTTGGACCTCTACTCGAGTAGAGGTCCAAATAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031436.2-784s1c1
Sequence:CCGGCCTGATAGACAACCCTGTGATCTCGAGATCACAGGGTTGTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-307s1c1
Sequence:CCGGCACCTGCCATAAGAAGTCCTTCTCGAGAAGGACTTCTTATGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031436
VALIDATED
AKR1E2 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-596s1c1
Sequence:CCGGGTGTCAAACTTCAACCATGAACTCGAGTTCATGGTTGAAGTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-901s1c1
Sequence:CCGGCCCAAGTCACATTAAAGAGAACTCGAGTTCTCTTTAATGTGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031436.2-367s1c1
Sequence:CCGGGCTGAACTATTTGGACCTCTACTCGAGTAGAGGTCCAAATAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031436.2-784s1c1
Sequence:CCGGCCTGATAGACAACCCTGTGATCTCGAGATCACAGGGTTGTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031436.2-307s1c1
Sequence:CCGGCACCTGCCATAAGAAGTCCTTCTCGAGAAGGACTTCTTATGGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040177
VALIDATED
AKR1E2 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-274s21c1
Sequence:CCGGGATCAAGGAAGGCGCTGTAAGCTCGAGCTTACAGCGCCTTCCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-522s21c1
Sequence:CCGGACGAGAGCAACATGGTTATTCCTCGAGGAATAACCATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040177.1-1054s21c1
Sequence:CCGGCTATCCTTTCCACATAGAATACTCGAGTATTCTATGTGGAAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040177.1-1318s21c1
Sequence:CCGGGATGAGTCATCAGTGAAATTTCTCGAGAAATTTCACTGATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-964s21c1
Sequence:CCGGTGAATTAACACAGCACGATATCTCGAGATATCGTGCTGTGTTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040177
VALIDATED
AKR1E2 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-274s21c1
Sequence:CCGGGATCAAGGAAGGCGCTGTAAGCTCGAGCTTACAGCGCCTTCCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-522s21c1
Sequence:CCGGACGAGAGCAACATGGTTATTCCTCGAGGAATAACCATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040177.1-1054s21c1
Sequence:CCGGCTATCCTTTCCACATAGAATACTCGAGTATTCTATGTGGAAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040177.1-1318s21c1
Sequence:CCGGGATGAGTCATCAGTGAAATTTCTCGAGAAATTTCACTGATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-964s21c1
Sequence:CCGGTGAATTAACACAGCACGATATCTCGAGATATCGTGCTGTGTTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040177
VALIDATED
AKR1E2 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 1, member E2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-274s21c1
Sequence:CCGGGATCAAGGAAGGCGCTGTAAGCTCGAGCTTACAGCGCCTTCCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-522s21c1
Sequence:CCGGACGAGAGCAACATGGTTATTCCTCGAGGAATAACCATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040177.1-1054s21c1
Sequence:CCGGCTATCCTTTCCACATAGAATACTCGAGTATTCTATGTGGAAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040177.1-1318s21c1
Sequence:CCGGGATGAGTCATCAGTGAAATTTCTCGAGAAATTTCACTGATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040177.1-964s21c1
Sequence:CCGGTGAATTAACACAGCACGATATCTCGAGATATCGTGCTGTGTTAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks