EMAIL THIS PAGE TO A FRIEND

AKR7A2

aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)

Synonyms: AFAR AFAR1 AFB1-AR1 AKR7
UniProtKB ID: O43488, O75749, Q5TG63
Gene ID:
Human(8574) Summary: The protein encoded by this gene belongs to the aldo/keto reductase (AKR) superfamily and AKR7 family, which are involved in the detoxification of aldehydes and ketones. The AKR7 family consists of 3 genes that are present in a cluster on the p arm of chromosome 1. This protein, thought to be localized in the golgi, catalyzes the NADPH-dependent reduction of succinic semialdehyde to the endogenous neuromodulator, gamma-hydroxybutyrate. It may also function as a detoxication enzyme in the reduction of aflatoxin B1 and 2-carboxybenzaldehyde. [provided by RefSeq, Oct 2011]
Rat(171445) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
chicken(419471) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
cow(511996) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
domestic cat(101089785) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
dog(478210) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
naked mole-rat(101705538) aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108661 MISSION® esiRNA esiRNA human AKR7A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003689 Rosetta Predictions human pricing
NM_134407 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336106 predicted 833
2 SASI_Hs01_00067436 predicted 227
3 SASI_Hs02_00336107 predicted 831
4 SASI_Hs02_00336108 predicted 425
5 SASI_Hs02_00336109 predicted 990
6 SASI_Hs01_00067442 predicted 222
7 SASI_Hs01_00067444 predicted 820
8 SASI_Hs02_00336110 predicted 532
9 SASI_Hs02_00336111 predicted 1240
10 SASI_Hs02_00336112 predicted 1311
11 SASI_Hs01_00067435 predicted 608
12 SASI_Hs01_00067437 predicted 1065
13 SASI_Hs01_00067438 predicted 1062
14 SASI_Hs01_00067439 predicted 720
15 SASI_Hs01_00067440 predicted 1061
16 SASI_Hs01_00067441 predicted 683
17 SASI_Hs01_00067443 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033968 predicted 195
2 SASI_Rn01_00033969 predicted 483
3 SASI_Rn01_00033970 predicted 681
4 SASI_Rn01_00033971 predicted 351
5 SASI_Rn02_00268002 predicted 525
6 SASI_Rn01_00033972 predicted 828
7 SASI_Rn02_00268003 predicted 526
8 SASI_Rn01_00033973 predicted 738
9 SASI_Rn01_00033974 predicted 691
10 SASI_Rn01_00033975 predicted 630
11 SASI_Rn01_00033976 predicted 957
12 SASI_Rn01_00033977 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003689
VALIDATED
AKR7A2 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-388s21c1
Sequence:CCGGGCTGGAGACGTCATTGAAGAGCTCGAGCTCTTCAATGACGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-426s21c1
Sequence:CCGGTGGACCTCTTCTACCTACACGCTCGAGCGTGTAGGTAGAAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-526s21c1
Sequence:CCGGTGGCCTCTCCAACTATGCTAGCTCGAGCTAGCATAGTTGGAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-1207s21c1
Sequence:CCGGGTCTAGATCCATGCATTATTTCTCGAGAAATAATGCATGGATCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-796s21c1
Sequence:CCGGGACCTACAGGAATCGCTTCTGCTCGAGCAGAAGCGATTCCTGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-229s1c1
Sequence:CCGGCGAACTGGACACGGCCTTCATCTCGAGATGAAGGCCGTGTCCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003689.2-992s1c1
Sequence:CCGGGAGCAGAACTTGGCAGCAACACTCGAGTGTTGCTGCCAAGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-793s1c1
Sequence:CCGGTGAGACCTACAGGAATCGCTTCTCGAGAAGCGATTCCTGTAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-1047s1c1
Sequence:CCGGCCTTTAATCAAGCCTGGCATTCTCGAGAATGCCAGGCTTGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003689
VALIDATED
AKR7A2 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-388s21c1
Sequence:CCGGGCTGGAGACGTCATTGAAGAGCTCGAGCTCTTCAATGACGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-426s21c1
Sequence:CCGGTGGACCTCTTCTACCTACACGCTCGAGCGTGTAGGTAGAAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-526s21c1
Sequence:CCGGTGGCCTCTCCAACTATGCTAGCTCGAGCTAGCATAGTTGGAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-1207s21c1
Sequence:CCGGGTCTAGATCCATGCATTATTTCTCGAGAAATAATGCATGGATCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-796s21c1
Sequence:CCGGGACCTACAGGAATCGCTTCTGCTCGAGCAGAAGCGATTCCTGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-229s1c1
Sequence:CCGGCGAACTGGACACGGCCTTCATCTCGAGATGAAGGCCGTGTCCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003689.2-992s1c1
Sequence:CCGGGAGCAGAACTTGGCAGCAACACTCGAGTGTTGCTGCCAAGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-793s1c1
Sequence:CCGGTGAGACCTACAGGAATCGCTTCTCGAGAAGCGATTCCTGTAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-1047s1c1
Sequence:CCGGCCTTTAATCAAGCCTGGCATTCTCGAGAATGCCAGGCTTGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003689
VALIDATED
AKR7A2 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-388s21c1
Sequence:CCGGGCTGGAGACGTCATTGAAGAGCTCGAGCTCTTCAATGACGTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-426s21c1
Sequence:CCGGTGGACCTCTTCTACCTACACGCTCGAGCGTGTAGGTAGAAGAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-526s21c1
Sequence:CCGGTGGCCTCTCCAACTATGCTAGCTCGAGCTAGCATAGTTGGAGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232711    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-1207s21c1
Sequence:CCGGGTCTAGATCCATGCATTATTTCTCGAGAAATAATGCATGGATCTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003689.2-796s21c1
Sequence:CCGGGACCTACAGGAATCGCTTCTGCTCGAGCAGAAGCGATTCCTGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-229s1c1
Sequence:CCGGCGAACTGGACACGGCCTTCATCTCGAGATGAAGGCCGTGTCCAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003689.2-992s1c1
Sequence:CCGGGAGCAGAACTTGGCAGCAACACTCGAGTGTTGCTGCCAAGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-793s1c1
Sequence:CCGGTGAGACCTACAGGAATCGCTTCTCGAGAAGCGATTCCTGTAGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003689.2-1047s1c1
Sequence:CCGGCCTTTAATCAAGCCTGGCATTCTCGAGAATGCCAGGCTTGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks