EMAIL THIS PAGE TO A FRIEND

AKR7A3

aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)

41 Gene Product Result for
Synonyms: AFAR2
UniProtKB ID: O95154, Q86SR4, Q8IVN6, Q8N5V6, Q8TAX1, Q9NUC3
Gene ID:
Human(22977) Summary: Aldo-keto reductases, such as AKR7A3, are involved in the detoxification of aldehydes and ketones.[supplied by OMIM, Apr 2004]
Rat(26760) aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Zebrafish(436642) aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
cow(788425) aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
naked mole-rat(101702417) aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
domestic guinea pig(100724386) aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400435 Anti-AKR7A3 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2103216 Anti-AKR7A3 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, zebrafish, human, mouse, horse, rat
western blot pricing
SAB2700928 Anti-AKR7A3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP6085 AKR7A3 human recombinant, expressed in E. coli, ≥95% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012067 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126881 MISSION® esiRNA esiRNA human AKR7A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012067 Rosetta Predictions human pricing
NM_013215 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075484 predicted 301
2 SASI_Hs01_00075487 predicted 409
3 SASI_Hs01_00075485 predicted 337
4 SASI_Hs01_00075486 predicted 811
5 SASI_Hs01_00075488 predicted 1104
6 SASI_Hs01_00075489 predicted 1091
7 SASI_Hs01_00075490 predicted 1171
8 SASI_Hs01_00075491 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261076 predicted 291
2 SASI_Rn02_00261077 predicted 915
3 SASI_Rn01_00109440 predicted 621
4 SASI_Rn01_00109441 predicted 1034
5 SASI_Rn01_00109442 predicted 772
6 SASI_Rn01_00109443 predicted 472
7 SASI_Rn01_00109445 predicted 1034
8 SASI_Rn01_00109446 predicted 718
9 SASI_Rn01_00109447 predicted 498
10 SASI_Rn01_00109448 predicted 215
11 SASI_Rn01_00109444 predicted 758
12 SASI_Rn01_00109449 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012067
AKR7A3 MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-197s1c1
Sequence:CCGGCACCGAGATAGACACGGCCTTCTCGAGAAGGCCGTGTCTATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-764s1c1
Sequence:CCGGAGAGATGTACAGGAATCGCTACTCGAGTAGCGATTCCTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-402s1c1
Sequence:CCGGCTCTTCTACCTGCATATGCCACTCGAGTGGCATATGCAGGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-698s1c1
Sequence:CCGGCAAGTACAAGTATGAGGACAACTCGAGTTGTCCTCATACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-317s1c1
Sequence:CCGGACTGTTTGGGAACTCCCTGAACTCGAGTTCAGGGAGTTCCCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-1065s21c1
Sequence:CCGGTTCCGCTAGGCCCATCGTTTCCTCGAGGAAACGATGGGCCTAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012067.2-1098s21c1
Sequence:GTACCGGAGGCTCTTCTGTAACATCTTTCTCGAGAAAGATGTTACAGAAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-766s21c1
Sequence:CCGGAGATGTACAGGAATCGCTACTCTCGAGAGTAGCGATTCCTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-398s21c1
Sequence:CCGGGGACCTCTTCTACCTGCATATCTCGAGATATGCAGGTAGAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-302s21c1
Sequence:CCGGTACCAAGGCCATTCCACTGTTCTCGAGAACAGTGGAATGGCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012067
AKR7A3 MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-197s1c1
Sequence:CCGGCACCGAGATAGACACGGCCTTCTCGAGAAGGCCGTGTCTATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-764s1c1
Sequence:CCGGAGAGATGTACAGGAATCGCTACTCGAGTAGCGATTCCTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-402s1c1
Sequence:CCGGCTCTTCTACCTGCATATGCCACTCGAGTGGCATATGCAGGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-698s1c1
Sequence:CCGGCAAGTACAAGTATGAGGACAACTCGAGTTGTCCTCATACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-317s1c1
Sequence:CCGGACTGTTTGGGAACTCCCTGAACTCGAGTTCAGGGAGTTCCCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-1065s21c1
Sequence:CCGGTTCCGCTAGGCCCATCGTTTCCTCGAGGAAACGATGGGCCTAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012067.2-1098s21c1
Sequence:GTACCGGAGGCTCTTCTGTAACATCTTTCTCGAGAAAGATGTTACAGAAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-766s21c1
Sequence:CCGGAGATGTACAGGAATCGCTACTCTCGAGAGTAGCGATTCCTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-398s21c1
Sequence:CCGGGGACCTCTTCTACCTGCATATCTCGAGATATGCAGGTAGAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-302s21c1
Sequence:CCGGTACCAAGGCCATTCCACTGTTCTCGAGAACAGTGGAATGGCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012067
AKR7A3 MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-197s1c1
Sequence:CCGGCACCGAGATAGACACGGCCTTCTCGAGAAGGCCGTGTCTATCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-764s1c1
Sequence:CCGGAGAGATGTACAGGAATCGCTACTCGAGTAGCGATTCCTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-402s1c1
Sequence:CCGGCTCTTCTACCTGCATATGCCACTCGAGTGGCATATGCAGGTAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-698s1c1
Sequence:CCGGCAAGTACAAGTATGAGGACAACTCGAGTTGTCCTCATACTTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012067.2-317s1c1
Sequence:CCGGACTGTTTGGGAACTCCCTGAACTCGAGTTCAGGGAGTTCCCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-1065s21c1
Sequence:CCGGTTCCGCTAGGCCCATCGTTTCCTCGAGGAAACGATGGGCCTAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012067.2-1098s21c1
Sequence:GTACCGGAGGCTCTTCTGTAACATCTTTCTCGAGAAAGATGTTACAGAAGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-766s21c1
Sequence:CCGGAGATGTACAGGAATCGCTACTCTCGAGAGTAGCGATTCCTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-398s21c1
Sequence:CCGGGGACCTCTTCTACCTGCATATCTCGAGATATGCAGGTAGAAGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012067.2-302s21c1
Sequence:CCGGTACCAAGGCCATTCCACTGTTCTCGAGAACAGTGGAATGGCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks