EMAIL THIS PAGE TO A FRIEND

AKR7L

aldo-keto reductase family 7-like

19 Gene Product Result for
Synonyms: AFAR3 AFB1-AR3 AKR7A4
UniProtKB ID: Q8NHP1, Q5U614
Gene ID:
cow(511995) aldo-keto reductase family 7-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201252 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201252 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160862 predicted 645
2 SASI_Hs01_00160864 predicted 619
3 SASI_Hs01_00160866 predicted 707
4 SASI_Hs01_00160867 predicted 624
5 SASI_Hs02_00372899 predicted 711
6 SASI_Hs02_00372900 predicted 786
7 SASI_Hs01_00160863 predicted 790
8 SASI_Hs01_00160858 predicted 239
9 SASI_Hs01_00160859 predicted 301
10 SASI_Hs01_00160860 predicted 294
11 SASI_Hs01_00160861 predicted 406
12 SASI_Hs01_00160865 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201252
AKR7L MISSION shRNA Bacterial Glycerol Stock
aldo-keto reductase family 7-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-366s1c1
Sequence:CCGGGTGTACCAGCTTCTGGAAGGACTCGAGTCCTTCCAGAAGCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-610s1c1
Sequence:CCGGGCCTTTAATCAAGCCTGGCATCTCGAGATGCCAGGCTTGATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-639s1c1
Sequence:CCGGCCACGAATGTCCCAACTACTTCTCGAGAAGTAGTTGGGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-475s1c1
Sequence:CCGGCGGTGGATGTACCACCACTCACTCGAGTGAGTGGTGGTACATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-267s1c1
Sequence:CCGGGAGGGCAAGTTCGTGGAGCTTCTCGAGAAGCTCCACGAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201252.3-1447s21c1
Sequence:CCGCCAGTTTCTCAAAGGATTAAACCTCGAGGTTTAATCCTTTGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-221s21c1
Sequence:CCGGTTGCTACCAAGGCCAATCCATCTCGAGATGGATTGGCCTTGGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-678s21c1
Sequence:CCGGTCAGTGGGCAGAGATCTACAGCTCGAGCTGTAGATCTCTGCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201252
AKR7L MISSION shRNA shRNA Plasmid DNA
aldo-keto reductase family 7-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-366s1c1
Sequence:CCGGGTGTACCAGCTTCTGGAAGGACTCGAGTCCTTCCAGAAGCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-610s1c1
Sequence:CCGGGCCTTTAATCAAGCCTGGCATCTCGAGATGCCAGGCTTGATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-639s1c1
Sequence:CCGGCCACGAATGTCCCAACTACTTCTCGAGAAGTAGTTGGGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-475s1c1
Sequence:CCGGCGGTGGATGTACCACCACTCACTCGAGTGAGTGGTGGTACATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-267s1c1
Sequence:CCGGGAGGGCAAGTTCGTGGAGCTTCTCGAGAAGCTCCACGAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201252.3-1447s21c1
Sequence:CCGCCAGTTTCTCAAAGGATTAAACCTCGAGGTTTAATCCTTTGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-221s21c1
Sequence:CCGGTTGCTACCAAGGCCAATCCATCTCGAGATGGATTGGCCTTGGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-678s21c1
Sequence:CCGGTCAGTGGGCAGAGATCTACAGCTCGAGCTGTAGATCTCTGCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201252
AKR7L MISSION shRNA Lentiviral Transduction Particles
aldo-keto reductase family 7-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-366s1c1
Sequence:CCGGGTGTACCAGCTTCTGGAAGGACTCGAGTCCTTCCAGAAGCTGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-610s1c1
Sequence:CCGGGCCTTTAATCAAGCCTGGCATCTCGAGATGCCAGGCTTGATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-639s1c1
Sequence:CCGGCCACGAATGTCCCAACTACTTCTCGAGAAGTAGTTGGGACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-475s1c1
Sequence:CCGGCGGTGGATGTACCACCACTCACTCGAGTGAGTGGTGGTACATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201252.1-267s1c1
Sequence:CCGGGAGGGCAAGTTCGTGGAGCTTCTCGAGAAGCTCCACGAACTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201252.3-1447s21c1
Sequence:CCGCCAGTTTCTCAAAGGATTAAACCTCGAGGTTTAATCCTTTGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-221s21c1
Sequence:CCGGTTGCTACCAAGGCCAATCCATCTCGAGATGGATTGGCCTTGGTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201252.3-678s21c1
Sequence:CCGGTCAGTGGGCAGAGATCTACAGCTCGAGCTGTAGATCTCTGCCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks