EMAIL THIS PAGE TO A FRIEND

AKT1

v-akt murine thymoma viral oncogene homolog 1

196 Gene Product Result for
Synonyms: AKT CWS6 PKB PKB-ALPHA PRKBA RAC RAC-ALPHA
UniProtKB ID: P31749, B2RAM5, Q9BWB6
Gene ID:
Human(207) Summary: The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(11651) thymoma viral proto-oncogene 1
Rat(24185) v-akt murine thymoma viral oncogene homolog 1
Zebrafish(101910198) v-akt murine thymoma viral oncogene homolog 1
cow(280991) v-akt murine thymoma viral oncogene homolog 1
domestic cat(101087931) v-akt murine thymoma viral oncogene homolog 1
dog(490878) v-akt murine thymoma viral oncogene homolog 1
fruit fly(41957) CG4006 gene product from transcript CG4006-RA
chicken(395928) v-akt murine thymoma viral oncogene homolog 1
naked mole-rat(101700695) v-akt murine thymoma viral oncogene homolog 1
domestic guinea pig(100714724) v-akt murine thymoma viral oncogene homolog 1
Goat(100860904) v-akt murine thymoma viral oncogene homolog 1
sheep(100294652) v-akt murine thymoma viral oncogene homolog 1
sheep(101104184) v-akt murine thymoma viral oncogene homolog 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500797 Anti-AKT antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4500799 Anti-AKT antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500800 Anti-AKT antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500802 Anti-AKT antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500803 Anti-AKT antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500796 Anti-AKT, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500798 Anti-AKT, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4500004 Anti-AKT, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500801 Anti-AKT, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300335 Anti-AKT1 (Ab-308) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300575 Anti-AKT1 (Ab-450) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300334 Anti-AKT1 (Ab-473) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
GW22757 Anti-AKT1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
GW22775 Anti-AKT1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB2501934 Anti-AKT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB3500216 Anti-Akt1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
HPA002891 Anti-AKT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV06008 Anti-AKT1 antibody produced in rabbit affinity isolated antibody human, mouse, goat, sheep, canine, bovine, rat, pig
western blot pricing
SAB4500007 Anti-AKT1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300574 Anti-AKT1/AKT2/AKT3 (Ab-315/316/312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4301170 Anti-pan-AKT antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4503853 Anti-phospho-Akt (pSer124) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301497 Anti-phospho-Akt (pSer124) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504016 Anti-phospho-Akt (pSer129) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301414 Anti-phospho-Akt (pSer129) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4504015 Anti-phospho-Akt (pSer246) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504332 Anti-phospho-Akt (pThr308) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4200753 Anti-phospho-AKT (pThr450) antibody, Mouse monoclonal clone AK-11, purified from hybridoma cell culture New mouse, rat, chicken, human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4504017 Anti-phospho-Akt (pThr72) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504110 Anti-phospho-Akt (pTyr326) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4504014 Anti-phospho-Akt (pTyr474) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1305993 ANTI-PHOSPHO-AKT(Y326) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300042 Anti-phospho-AKT1 (pSer473) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300043 Anti-phospho-AKT1 (pThr308) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504749 Anti-phospho-AKT1 (pThr308) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4503852 Anti-phospho-Akt1 (pThr450) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300260 Anti-phospho-AKT1 (pThr450) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504603 Anti-phospho-AKT1/3 (pTyr437/434) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300259 Anti-phospho-AKT1/AKT2/AKT3 (pTyr315/pTyr316/pTyr312) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
P4112 Anti-phospho-PKB (pSer473) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse
microarray, western blot pricing
P3862 Anti-phospho-PKB (pThr308) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat
microarray, western blot pricing
P1601 Anti-Protein Kinase Bα antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, bovine, human
microarray, western blot pricing
SAB3701426 Monoclonal Anti-AKT pS473 antibody produced in mouse clone 17F6.B11, purified immunoglobulin human, mouse, rat, monkey
ELISA, immunohistochemistry, western blot pricing
SAB3701427 Monoclonal Anti-AKT pT308 antibody produced in mouse clone 18F3.H11, purified immunoglobulin human, mouse, rat, monkey
ELISA, immunohistochemistry, western blot pricing
WH0000207M3 Monoclonal Anti-AKT1 antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400005 Monoclonal Anti-AKT1 antibody produced in mouse clone 6D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400006 Monoclonal Anti-AKT1 antibody produced in mouse clone 6G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400007 Monoclonal Anti-AKT1 antibody produced in mouse clone 2H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400008 Monoclonal Anti-AKT1 antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB90834 Monoclonal Anti-AKT1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0887, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
AMAB90835 Monoclonal Anti-AKT1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0899, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB1403538 Monoclonal Anti-AKT1, (C-terminal) antibody produced in mouse clone 4C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P2482 Monoclonal Anti-Protein Kinase Bα antibody produced in mouse clone PKB-175, ascites fluid bovine, rat, mouse, human, chicken
ELISA, microarray, western blot pricing
PLA0238 Rabbit anti-AKT1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, primate, marmoset, gibbon, gorilla, human, rhesus monkey
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
C6235 Crosstide ≥97% (HPLC), lyophilized powder human, mouse, rat pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1132 DLD1 CELLS AKT1 -/- human pricing

Kits

Product # Description Species Add to Cart
 
CS0160 Akt/PKB ELISA sufficient for 96 tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
12-340 Akt/SGK Substrate Peptide 500 µg, Akt/SGK Substrate Peptide primarily used in Kinase Assays. pricing
14-453-M Akt1/PKBα (δPH, S473D) Protein, active, 10 µg 10 µg, Active, N-terminal His6-tagged, recombinant human Akt1, residues 118-end containing the mutation S473D, for use in Kinase Assays. pricing
14-276-M Akt1/PKBα Protein, active, 15 µg 15 µg, Active, recombinant full-length human Akt1, containing N-terminal His6 tag, for use in IP-Kinase Assays & Kinase Assays. pricing
14-279 Akt1/PKBα Protein, unactive, 50 µg 50 µg, Unactive, N-terminal His6-tagged recombinant full-length human Akt1, for use in Kinase Assays. pricing
16-185 Anti-Akt/PKB Antibody, PH Domain, agarose conjugate 100 µg, Anti-Akt/PKB Antibody, PH Domain, agarose conjugate is an antibody against Akt/PKB for use in IP. pricing
05-591 Anti-Akt/PKB Antibody, PH Domain, clone SKB1 100 µg, Detect Akt/PKB using this Anti-Akt/PKB Antibody, PH Domain, clone SKB1 validated for use in FC, IC, IP & WB. pricing
05-591MG Anti-Akt/PKB Antibody, PH Domain, clone SKB1 1 mg, This Anti-Akt/PKB Antibody, PH Domain, clone SKB1 is validated for use in IP, WB for the detection of Akt/PKB. pricing
05-591-AF647 Anti-Akt/PKB Antibody, PH Domain, clone SKB1, Alexa Fluor® 647 100 µL, This Anti-Akt Antibody, PH Domain, clone SKB1, Alexa Fluor® 647 is validated for use in Immunocytochemistry for the detection of PKB. pricing
07-416 Anti-Akt1/PKBα Antibody 100 µg, This Anti-Akt1/PKBα Antibody is validated for use in IP, WB for the detection of Akt1/PKBα. pricing
05-796 Anti-Akt1/PKBα Antibody, clone AW24, rabbit monoclonal 100 µL, Detect Akt1/PKBα using this Anti-Akt1 Antibody, clone AW24 validated for use in IP & WB. pricing
07-789 Anti-phospho-AKT (Thr34) Antibody 100 µL, Anti-phospho-AKT (Thr34) Antibody detects level of phospho-AKT (Thr34) & has been published & validated for use in WB. pricing
07-1643 Anti-phospho-Akt (Tyr450) Antibody 100 µg, Anti-phospho-Akt (Tyr450) Antibody is an antibody against phospho-Akt (Tyr450) for use in WB, EA. pricing
ABS1526 Anti-phospho-AKT1 Antibody, Thr479 100 μg, Anti-phospho-AKT1, Thr479, Cat. No. ABS1526, is a rabbit polyclonal antibody that detects AKT1 phosphorylated on Thr479 and has been tested for use in Western Blotting and Peptide Inhibition Assay. pricing
05-669 Anti-phospho-Akt1/PKBα (Ser473) Antibody, clone 11E6 100 µg, This Anti-Akt1 Antibody, clone 11E6 is validated for use in ELISA, WB for the detection of phospho-Akt1/PKBα (Ser473). pricing
16-305 Anti-phospho-Akt1/PKBα (Ser473) Antibody, clone 11E6, Alexa Fluor® 488 50 µg, Detect phospho-Akt1/PKBα (Ser473) using this Anti-Akt1 Antibody, clone 11E6, Alexa Fluor 488 validated for use in FC, IC, IF & WB. pricing
16-306 Anti-phospho-Akt1/PKBα (Ser473) Antibody, clone 11E6, Alexa Fluor® 555 50 µg, This Anti-Akt1 Antibody, clone 11E6, Alexa Fluor 555 is validated for use in FC, IC, IF, WB for the detection of phospho-Akt1/PKBα (Ser473). pricing
04-736 Anti-phospho-Akt1/PKBα (Ser473) Antibody, clone SK703, rabbit monoclonal 100 µl, Anti-Akt1 Antibody, clone SK703 detects level of phospho-Akt1/PKBα (Ser473) & has been published & validated for use in WB. pricing
05-736 Anti-phospho-Akt1/PKBα (Ser473) Antibody, clone SK703, rabbit monoclonal 100 µg, Detect phospho-Akt1/PKBα (Ser473) using this Anti-Akt1 Antibody, clone SK703 validated for use in WB. pricing
04-802 Anti-phospho-Akt1/PKBα (Thr308) Antibody, clone NL50, rabbit monoclonal 100 µL, This Anti-Akt1 Antibody, clone NL50 is validated for use in WB for the detection of phospho-Akt1/PKBα (Thr308). pricing
05-802 Anti-phospho-Akt1/PKBα (Thr308) Antibody, clone NL50, rabbit monoclonal 100 µL, Anti-Akt1 Antibody, clone NL50 is an antibody against phospho-Akt1/PKBα (Thr308) for use in WB. pricing
MABS776 Anti-phospho-Akt1 (Ser129), clone EPR6150, Rabbit Monoclonal Antibody 100 µL, This Anti-Akt1 antibody is validated for use in Western Blotting for the detection of phospho-Akt1 (Ser129). pricing
AB9927 Anti-phospho-Akt1 (Tyr326) Antibody 100 µg, Detect phospho-Akt1 (Tyr326) using this Anti-Akt1 Antibody validated for use in WB. pricing
21-151 Akt1/PKBα cDNA (activated) in pUSEamp 5 µg, Transfection grade eukaryotic expression vector containing Myc-His tagged mouse Akt1 (activated) under the control of the CMV promoter. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014431 Rosetta Predictions human pricing
NM_001014432 Rosetta Predictions human pricing
NM_005163 siRNAs that have been validated in the lab human pricing
NM_033230 Rosetta Predictions rat pricing
NM_009652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205545 predicted 1829
2 SASI_Hs01_00205546 predicted 963
3 SASI_Hs01_00205547 predicted 1633
4 SASI_Hs01_00205548 predicted 758
5 SASI_Hs01_00205549 predicted 1681
6 SASI_Hs01_00205550 predicted 1656
7 SASI_Hs01_00205551 predicted 590
8 SASI_Hs01_00205552 predicted 809
9 SASI_Hs01_00205554 predicted 1538
10 SASI_Hs02_00306535 predicted 1103
11 SASI_Hs01_00205553 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046168 predicted 1913
2 SASI_Hs01_00046169 predicted 1043
3 SASI_Hs01_00046170 predicted 1709
4 SASI_Hs01_00046171 predicted 841
5 SASI_Hs01_00046172 predicted 1759
6 SASI_Hs01_00046173 predicted 1738
7 SASI_Hs01_00046174 predicted 676
8 SASI_Hs01_00046175 predicted 895
9 SASI_Hs01_00046177 predicted 1616
10 SASI_Hs02_00306536 predicted 1184
11 SASI_Hs01_00046176 predicted 2303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005163 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105953 validated 1178
1 SASI_Hs01_00105954 validated 1839
1 SASI_Hs01_00105952 validated 2050
2 SASI_Hs01_00105955 predicted 970
3 SASI_Hs01_00105956 predicted 1895
4 SASI_Hs01_00105957 predicted 1869
5 SASI_Hs01_00105958 predicted 803
6 SASI_Hs01_00105959 predicted 1028
7 SASI_Hs01_00105961 predicted 1747
8 SASI_Hs02_00339106 predicted 1313
9 SASI_Hs01_00105960 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063656 predicted 894
2 SASI_Rn02_00265509 predicted 214
3 SASI_Rn01_00063658 predicted 464
4 SASI_Rn01_00063659 predicted 385
5 SASI_Rn01_00063660 predicted 609
6 SASI_Rn01_00063661 predicted 1108
7 SASI_Rn02_00265510 predicted 910
8 SASI_Rn01_00063662 predicted 963
9 SASI_Rn01_00063663 predicted 352
10 SASI_Rn01_00063664 predicted 1331
11 SASI_Rn01_00063657 predicted 1382
12 SASI_Rn01_00063665 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316647 predicted 1031
2 SASI_Mm01_00173533 predicted 764
3 SASI_Mm01_00173536 predicted 1492
4 SASI_Mm01_00173538 predicted 391
5 SASI_Mm01_00173540 predicted 1034
6 SASI_Mm01_00173542 predicted 918
7 SASI_Mm02_00316648 predicted 1175
8 SASI_Mm02_00316649 predicted 523
9 SASI_Mm02_00316650 predicted 716
10 SASI_Mm02_00316651 predicted 370
11 SASI_Mm01_00173534 predicted 768
12 SASI_Mm01_00173535 predicted 1177
13 SASI_Mm01_00173537 predicted 764
14 SASI_Mm01_00173539 predicted 871
15 SASI_Mm01_00173541 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009652
VALIDATED
AKT1 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-714s21c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-1575s21c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-380s21c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-526s21c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009652.2-1142s21c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-525s1c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-889s1c1
Sequence:CCGGGCAGAACTCTAGGCATCCCTTCTCGAGAAGGGATGCCTAGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1519s1c1
Sequence:CCGGGTGGCAGGATGTGTATGAGAACTCGAGTTCTCATACACATCCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1636s1c1
Sequence:CCGGGCCTGATCAAGATGACAGCATCTCGAGATGCTGTCATCTTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1069s1c1
Sequence:CCGGCTACTTGCACTCCGAGAAGAACTCGAGTTCTTCTCGGAGTGCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1141s1c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009652.1-1033s1c1
Sequence:CCGGCCGCTTCTATGGTGCGGAGATCTCGAGATCTCCGCACCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-713s1c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1574s1c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-379s1c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009652
VALIDATED
AKT1 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-714s21c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-1575s21c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-380s21c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-526s21c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009652.2-1142s21c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-525s1c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-889s1c1
Sequence:CCGGGCAGAACTCTAGGCATCCCTTCTCGAGAAGGGATGCCTAGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1519s1c1
Sequence:CCGGGTGGCAGGATGTGTATGAGAACTCGAGTTCTCATACACATCCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1636s1c1
Sequence:CCGGGCCTGATCAAGATGACAGCATCTCGAGATGCTGTCATCTTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1069s1c1
Sequence:CCGGCTACTTGCACTCCGAGAAGAACTCGAGTTCTTCTCGGAGTGCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1141s1c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009652.1-1033s1c1
Sequence:CCGGCCGCTTCTATGGTGCGGAGATCTCGAGATCTCCGCACCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-713s1c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1574s1c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-379s1c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009652
VALIDATED
AKT1 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-714s21c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-1575s21c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-380s21c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009652.2-526s21c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009652.2-1142s21c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-525s1c1
Sequence:CCGGCCACAGTCATTGAGCGCACCTCTCGAGAGGTGCGCTCAATGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-889s1c1
Sequence:CCGGGCAGAACTCTAGGCATCCCTTCTCGAGAAGGGATGCCTAGAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1519s1c1
Sequence:CCGGGTGGCAGGATGTGTATGAGAACTCGAGTTCTCATACACATCCTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1636s1c1
Sequence:CCGGGCCTGATCAAGATGACAGCATCTCGAGATGCTGTCATCTTGATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1069s1c1
Sequence:CCGGCTACTTGCACTCCGAGAAGAACTCGAGTTCTTCTCGGAGTGCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1141s1c1
Sequence:CCGGGCACATCAAGATAACGGACTTCTCGAGAAGTCCGTTATCTTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009652.1-1033s1c1
Sequence:CCGGCCGCTTCTATGGTGCGGAGATCTCGAGATCTCCGCACCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-713s1c1
Sequence:CCGGCGTGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-1574s1c1
Sequence:CCGGTCTGAGACTGACACCAGGTATCTCGAGATACCTGGTGTCAGTCTCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009652.1-379s1c1
Sequence:CCGGTGGCACCTTTATTGGCTACAACTCGAGTTGTAGCCAATAAAGGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005163
VALIDATED
AKT1 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-984s21c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1091s21c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1400s21c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1337s21c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005163.1-267s1c1
Sequence:CCGGGCCACGCTACTTCCTCCTCAACTCGAGTTGAGGAGGAAGTAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-628s1c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-735s1c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005163.1-1694s1c1
Sequence:CCGGCGTGCCATGATCTGTATTTAACTCGAGTTAAATACAGATCATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005163.1-1410s1c1
Sequence:CCGGGCATCGCTTCTTTGCCGGTATCTCGAGATACCGGCAAAGAAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-1044s1c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-981s1c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.x-954s1c1
Sequence:CCGGCTATGGCGCTGAGATTGTGTCCTCGAGGACACAATCTCAGCGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-642s1c1
Sequence:CCGGCGAGTTTGAGTACCTGAAGCTCTCGAGAGCTTCAGGTACTCAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-652s1c1
Sequence:CCGGGCACCTTCATTGGCTACAAGGCTCGAGCCTTGTAGCCAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-1793s1c1
Sequence:CCGGGCAGCACGTGTACGAGAAGAACTCGAGTTCTTCTCGTACACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005163
VALIDATED
AKT1 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-984s21c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1091s21c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1400s21c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1337s21c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005163.1-267s1c1
Sequence:CCGGGCCACGCTACTTCCTCCTCAACTCGAGTTGAGGAGGAAGTAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-628s1c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-735s1c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005163.1-1694s1c1
Sequence:CCGGCGTGCCATGATCTGTATTTAACTCGAGTTAAATACAGATCATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005163.1-1410s1c1
Sequence:CCGGGCATCGCTTCTTTGCCGGTATCTCGAGATACCGGCAAAGAAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-1044s1c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-981s1c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.x-954s1c1
Sequence:CCGGCTATGGCGCTGAGATTGTGTCCTCGAGGACACAATCTCAGCGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-642s1c1
Sequence:CCGGCGAGTTTGAGTACCTGAAGCTCTCGAGAGCTTCAGGTACTCAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-652s1c1
Sequence:CCGGGCACCTTCATTGGCTACAAGGCTCGAGCCTTGTAGCCAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-1793s1c1
Sequence:CCGGGCAGCACGTGTACGAGAAGAACTCGAGTTCTTCTCGTACACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005163
VALIDATED
AKT1 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-984s21c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1091s21c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1400s21c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005163.2-1337s21c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A-431
TRC Version: 1 Clone ID:NM_005163.1-267s1c1
Sequence:CCGGGCCACGCTACTTCCTCCTCAACTCGAGTTGAGGAGGAAGTAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-628s1c1
Sequence:CCGGCGCGTGACCATGAACGAGTTTCTCGAGAAACTCGTTCATGGTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.1-735s1c1
Sequence:CCGGGATCCTCAAGAAGGAAGTCATCTCGAGATGACTTCCTTCTTGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005163.1-1694s1c1
Sequence:CCGGCGTGCCATGATCTGTATTTAACTCGAGTTAAATACAGATCATGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005163.1-1410s1c1
Sequence:CCGGGCATCGCTTCTTTGCCGGTATCTCGAGATACCGGCAAAGAAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-1044s1c1
Sequence:CCGGGGACAAGGACGGGCACATTAACTCGAGTTAATGTGCCCGTCCTTGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-981s1c1
Sequence:CCGGGGACTACCTGCACTCGGAGAACTCGAGTTCTCCGAGTGCAGGTAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005163.x-954s1c1
Sequence:CCGGCTATGGCGCTGAGATTGTGTCCTCGAGGACACAATCTCAGCGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005163.x-642s1c1
Sequence:CCGGCGAGTTTGAGTACCTGAAGCTCTCGAGAGCTTCAGGTACTCAAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-652s1c1
Sequence:CCGGGCACCTTCATTGGCTACAAGGCTCGAGCCTTGTAGCCAATGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005163.2-1793s1c1
Sequence:CCGGGCAGCACGTGTACGAGAAGAACTCGAGTTCTTCTCGTACACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks