EMAIL THIS PAGE TO A FRIEND

AKT1S1

AKT1 substrate 1 (proline-rich)

99 Gene Product Result for
Synonyms: Lobe PRAS40
Gene ID:
Human(84335) Summary: AKT1S1 is a proline-rich substrate of AKT (MIM 164730) that binds 14-3-3 protein (see YWHAH, MIM 113508) when phosphorylated (Kovacina et al., 2003 [PubMed 12524439]
Mouse(67605) AKT1 substrate 1 (proline-rich)
Rat(292887) AKT1 substrate 1 (proline-rich)
sheep(101109114) AKT1 substrate 1 (proline-rich)
domestic guinea pig(100722328) AKT1 substrate 1 (proline-rich)
naked mole-rat(101712955) AKT1 substrate 1 (proline-rich)
Zebrafish(566559) AKT1 substrate 1 (proline-rich)
cow(514859) AKT1 substrate 1 (proline-rich)
domestic cat(101100932) AKT1 substrate 1 (proline-rich)
dog(610130) AKT1 substrate 1 (proline-rich)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503348 Anti-AKT1 S1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2100092 Anti-AKT1S1 antibody produced in rabbit affinity isolated antibody canine, guinea pig, horse, bovine, mouse, rat, human
western blot pricing
HPA043590 Anti-AKT1S1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA064427 Anti-AKT1S1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
SAB4503893 Anti-phospho-Akt1 S1 (pThr246) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4200407 Anti-phospho-PRAS40 (pSer183) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB4200448 Anti-Phospho-PRAS40 (pThr246) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200312 Anti-PRAS40 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4200256 Monoclonal Anti-AKT1S1 antibody produced in mouse ~1.0 mg/mL, clone AKT1S1-3, purified immunoglobulin human
immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026491 MISSION® esiRNA esiRNA targeting mouse Akt1s1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098632 Rosetta Predictions human pricing
NM_001098633 Rosetta Predictions human pricing
NM_032375 Rosetta Predictions human pricing
NM_001106259 Rosetta Predictions rat pricing
NM_026270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319621 predicted 1368
2 SASI_Hs02_00319622 predicted 1329
3 SASI_Hs02_00319623 predicted 1211
4 SASI_Hs02_00319624 predicted 1097
5 SASI_Hs02_00319625 predicted 1525
6 SASI_Hs02_00319626 predicted 1126
7 SASI_Hs02_00319627 predicted 1403
8 SASI_Hs02_00319628 predicted 1538
9 SASI_Hs02_00319629 predicted 1090
10 SASI_Hs02_00319630 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319631 predicted 1123
2 SASI_Hs02_00319632 predicted 1079
3 SASI_Hs02_00319633 predicted 961
4 SASI_Hs02_00319634 predicted 852
5 SASI_Hs02_00319635 predicted 1280
6 SASI_Hs02_00319636 predicted 879
7 SASI_Hs02_00319637 predicted 1158
8 SASI_Hs02_00319638 predicted 1297
9 SASI_Hs02_00319639 predicted 850
10 SASI_Hs02_00319640 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212421 predicted 1726
2 SASI_Hs01_00212422 predicted 1685
3 SASI_Hs01_00212423 predicted 1565
4 SASI_Hs01_00212424 predicted 1448
5 SASI_Hs01_00212425 predicted 1887
6 SASI_Hs01_00212426 predicted 1482
7 SASI_Hs01_00212427 predicted 1759
8 SASI_Hs01_00212428 predicted 1889
9 SASI_Hs01_00212429 predicted 1449
10 SASI_Hs01_00212430 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217208 predicted 900
2 SASI_Rn02_00217209 predicted 730
3 SASI_Rn02_00217210 predicted 593
4 SASI_Rn02_00217211 predicted 374
5 SASI_Rn02_00217212 predicted 533
6 SASI_Rn02_00217213 predicted 849
7 SASI_Rn02_00217214 predicted 442
8 SASI_Rn02_00217215 predicted 377
9 SASI_Rn02_00217216 predicted 828
10 SASI_Rn02_00217217 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176239 predicted 714
2 SASI_Mm01_00176240 predicted 496
3 SASI_Mm01_00176242 predicted 874
4 SASI_Mm01_00176243 predicted 649
5 SASI_Mm01_00176244 predicted 694
6 SASI_Mm01_00176245 predicted 855
7 SASI_Mm01_00176246 predicted 198
8 SASI_Mm01_00176247 predicted 507
9 SASI_Mm01_00176248 predicted 555
10 SASI_Mm02_00329960 predicted 885
11 SASI_Mm01_00176241 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026270
VALIDATED
AKT1S1 MISSION shRNA Bacterial Glycerol Stock
AKT1 substrate 1 (proline-rich)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000198713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-1299s1c1
Sequence:CCGGCCTGACAATTGTATCCCGGTTCTCGAGAACCGGGATACAATTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-734s1c1
Sequence:CCGGCGATCGTCAGATGAGGAGAATCTCGAGATTCTCCTCATCTGACGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-883s1c1
Sequence:CCGGGAAGCTGAAGCGGAAATATTACTCGAGTAATATTTCCGCTTCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-865s1c1
Sequence:CCGGCAATACCAGCGACTTCCAGAACTCGAGTTCTGGAAGTCGCTGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026270
VALIDATED
AKT1S1 MISSION shRNA shRNA Plasmid DNA
AKT1 substrate 1 (proline-rich)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000198713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-1299s1c1
Sequence:CCGGCCTGACAATTGTATCCCGGTTCTCGAGAACCGGGATACAATTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-734s1c1
Sequence:CCGGCGATCGTCAGATGAGGAGAATCTCGAGATTCTCCTCATCTGACGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-883s1c1
Sequence:CCGGGAAGCTGAAGCGGAAATATTACTCGAGTAATATTTCCGCTTCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-865s1c1
Sequence:CCGGCAATACCAGCGACTTCCAGAACTCGAGTTCTGGAAGTCGCTGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026270
VALIDATED
AKT1S1 MISSION shRNA Lentiviral Transduction Particles
AKT1 substrate 1 (proline-rich)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000198713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-1299s1c1
Sequence:CCGGCCTGACAATTGTATCCCGGTTCTCGAGAACCGGGATACAATTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-734s1c1
Sequence:CCGGCGATCGTCAGATGAGGAGAATCTCGAGATTCTCCTCATCTGACGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-883s1c1
Sequence:CCGGGAAGCTGAAGCGGAAATATTACTCGAGTAATATTTCCGCTTCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026270.1-865s1c1
Sequence:CCGGCAATACCAGCGACTTCCAGAACTCGAGTTCTGGAAGTCGCTGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032375
AKT1S1 MISSION shRNA Bacterial Glycerol Stock
AKT1 substrate 1 (proline-rich)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1060s1c1
Sequence:CCGGCTCTTTGTGATGGATGAGGACCTCGAGGTCCTCATCCATCACAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1425s1c1
Sequence:CCGGCCAGAAGCTGAAGCGGAAATACTCGAGTATTTCCGCTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1032s1c1
Sequence:CCGGGCAGCTGGGCATTAGTGATAACTCGAGTTATCACTAATGCCCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1059s1c1
Sequence:CCGGGCTCTTTGTGATGGATGAGGACTCGAGTCCTCATCCATCACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1254s1c1
Sequence:CCGGCTTCAAGGAGAAGAGGACAGACTCGAGTCTGTCCTCTTCTCCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1963s1c1
Sequence:CCGGGCCTTCAATTTACGTTCTTTACTCGAGTAAAGAACGTAAATTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1684s1c1
Sequence:CCGGGCGACAGATTCCTTCTATTAACTCGAGTTAATAGAAGGAATCTGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032375.3-1688s21c1
Sequence:CCGGATCTGTCCCGTTTCCCGATTGCTCGAGCAATCGGGAAACGGGACAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032375.3-1465s21c1
Sequence:CCGGAGCGACTTCCAGAAGCTGAAGCTCGAGCTTCAGCTTCTGGAAGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032375
AKT1S1 MISSION shRNA shRNA Plasmid DNA
AKT1 substrate 1 (proline-rich)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1060s1c1
Sequence:CCGGCTCTTTGTGATGGATGAGGACCTCGAGGTCCTCATCCATCACAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1425s1c1
Sequence:CCGGCCAGAAGCTGAAGCGGAAATACTCGAGTATTTCCGCTTCAGCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1032s1c1
Sequence:CCGGGCAGCTGGGCATTAGTGATAACTCGAGTTATCACTAATGCCCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1059s1c1
Sequence:CCGGGCTCTTTGTGATGGATGAGGACTCGAGTCCTCATCCATCACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1254s1c1
Sequence:CCGGCTTCAAGGAGAAGAGGACAGACTCGAGTCTGTCCTCTTCTCCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1963s1c1
Sequence:CCGGGCCTTCAATTTACGTTCTTTACTCGAGTAAAGAACGTAAATTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1684s1c1
Sequence:CCGGGCGACAGATTCCTTCTATTAACTCGAGTTAATAGAAGGAATCTGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032375.3-1688s21c1
Sequence:CCGGATCTGTCCCGTTTCCCGATTGCTCGAGCAATCGGGAAACGGGACAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032375.3-1465s21c1
Sequence:CCGGAGCGACTTCCAGAAGCTGAAGCTCGAGCTTCAGCTTCTGGAAGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032375
AKT1S1 MISSION shRNA Lentiviral Transduction Particles
AKT1 substrate 1 (proline-rich)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1060s1c1
Sequence:CCGGCTCTTTGTGATGGATGAGGACCTCGAGGTCCTCATCCATCACAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1425s1c1
Sequence:CCGGCCAGAAGCTGAAGCGGAAATACTCGAGTATTTCCGCTTCAGCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1032s1c1
Sequence:CCGGGCAGCTGGGCATTAGTGATAACTCGAGTTATCACTAATGCCCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1059s1c1
Sequence:CCGGGCTCTTTGTGATGGATGAGGACTCGAGTCCTCATCCATCACAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032375.2-1254s1c1
Sequence:CCGGCTTCAAGGAGAAGAGGACAGACTCGAGTCTGTCCTCTTCTCCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1963s1c1
Sequence:CCGGGCCTTCAATTTACGTTCTTTACTCGAGTAAAGAACGTAAATTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032375.2-1684s1c1
Sequence:CCGGGCGACAGATTCCTTCTATTAACTCGAGTTAATAGAAGGAATCTGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032375.3-1688s21c1
Sequence:CCGGATCTGTCCCGTTTCCCGATTGCTCGAGCAATCGGGAAACGGGACAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032375.3-1465s21c1
Sequence:CCGGAGCGACTTCCAGAAGCTGAAGCTCGAGCTTCAGCTTCTGGAAGTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)