EMAIL THIS PAGE TO A FRIEND

AKT2

v-akt murine thymoma viral oncogene homolog 2

119 Gene Product Result for
Synonyms: HIHGHH PKBB PKBBETA PRKBB RAC-BETA
UniProtKB ID: P31751, B2RBD8, Q0VAN1, Q68GC0
Gene ID:
Human(208) Summary: This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. [provided by RefSeq, Jul 2008]
Mouse(11652) thymoma viral proto-oncogene 2
Rat(25233) v-akt murine thymoma viral oncogene homolog 2
Zebrafish(378972) v-akt murine thymoma viral oncogene homolog 2
chicken(373973) v-akt murine thymoma viral oncogene homolog 2
domestic cat(100499544) v-akt murine thymoma viral oncogene homolog 2
cow(534923) v-akt murine thymoma viral oncogene homolog 2
Horse(100064671) v-akt murine thymoma viral oncogene homolog 2
dog(449021) v-akt murine thymoma viral oncogene homolog 2
naked mole-rat(101719164) v-akt murine thymoma viral oncogene homolog 2
domestic guinea pig(100719925) v-akt murine thymoma viral oncogene homolog 2
sheep(101119242) v-akt murine thymoma viral oncogene homolog 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300574 Anti-AKT1/AKT2/AKT3 (Ab-315/316/312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
A4732 Anti-AKT2 (121-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
A4857 Anti-AKT2 (454-469) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300423 Anti-AKT2 (Ab-474) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2501920 Anti-AKT2 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, rat, human
ELISA, western blot pricing
GW22776 Anti-AKT2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1411919 ANTI-AKT2 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411920 ANTI-AKT2 antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411921 ANTI-AKT2 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2103239 Anti-AKT2 antibody produced in rabbit affinity isolated antibody rat, canine, bovine, pig, mouse, horse, human, zebrafish
western blot pricing
HPA064521 Anti-AKT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4200727 Anti-AKT2 antibody, Mouse monoclonal clone AKT2(104), purified from hybridoma cell culture New mouse, rat, human
western blot pricing
SAB2104347 Anti-AKT2, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, horse, mouse, bovine, canine, human
western blot pricing
SAB4500808 Anti-AKT2, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504332 Anti-phospho-Akt (pThr308) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504603 Anti-phospho-AKT1/3 (pTyr437/434) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300259 Anti-phospho-AKT1/AKT2/AKT3 (pTyr315/pTyr316/pTyr312) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504333 Anti-phospho-Akt2 (pSer474) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300102 Anti-phospho-AKT2 (pSer474) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
WH0000208M1 Monoclonal Anti-AKT2 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300348 Monoclonal Anti-AKT2 antibody produced in mouse clone 1B6, ascites fluid human, rat, monkey
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB3701428 Monoclonal Anti-AKT2 antibody produced in rat clone 16G11.E8, purified immunoglobulin human
ELISA, immunohistochemistry, western blot pricing
PLA0245 Rabbit anti-AKT2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, human, rhesus monkey, chimpanzee, gorilla, baboon
immunoprecipitation, proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1133 DLD1 CELLS AKT2 -/- human pricing
CLLS1063 MCF10A CELLS AKT2 (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001626 siRNAs that have been validated in the lab human pricing
NM_017093 Rosetta Predictions rat pricing
NM_001110208 Rosetta Predictions mouse pricing
NM_007434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001626 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035055 validated 1277
1 SASI_Hs01_00035058 validated 426
1 SASI_Hs01_00035057 validated 1479
2 SASI_Hs02_00332190 predicted 797
3 SASI_Hs02_00332191 predicted 688
4 SASI_Hs02_00332192 predicted 831
5 SASI_Hs02_00332193 predicted 1559
6 SASI_Hs02_00332194 predicted 1618
7 SASI_Hs02_00332195 predicted 1623
8 SASI_Hs02_00332196 predicted 1567
9 SASI_Hs02_00332197 predicted 743
10 SASI_Hs02_00332198 predicted 1072
11 SASI_Hs01_00035056 predicted 1274
12 SASI_Hs01_00035059 predicted 411
13 SASI_Hs01_00035060 predicted 1421
14 SASI_Hs01_00035061 predicted 1492
15 SASI_Hs01_00035062 predicted 587
16 SASI_Hs01_00035063 predicted 676
17 SASI_Hs01_00035064 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047688 predicted 664
2 SASI_Rn01_00047689 predicted 581
3 SASI_Rn01_00047690 predicted 721
4 SASI_Rn01_00047691 predicted 433
5 SASI_Rn01_00047692 predicted 848
6 SASI_Rn01_00047693 predicted 541
7 SASI_Rn01_00047694 predicted 772
8 SASI_Rn01_00047695 predicted 673
9 SASI_Rn01_00047696 predicted 708
10 SASI_Rn01_00047697 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304936 predicted 1205
2 SASI_Mm02_00304937 predicted 780
3 SASI_Mm02_00304938 predicted 703
4 SASI_Mm02_00304939 predicted 1692
5 SASI_Mm02_00304940 predicted 936
6 SASI_Mm02_00304941 predicted 1617
7 SASI_Mm02_00304942 predicted 562
8 SASI_Mm02_00304943 predicted 972
9 SASI_Mm02_00304944 predicted 832
10 SASI_Mm02_00304945 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165904 predicted 965
2 SASI_Mm01_00165905 predicted 543
3 SASI_Mm01_00165907 predicted 466
4 SASI_Mm01_00165908 predicted 1444
5 SASI_Mm01_00165909 predicted 697
6 SASI_Mm01_00165910 predicted 1373
7 SASI_Mm01_00165911 predicted 320
8 SASI_Mm01_00165912 predicted 727
9 SASI_Mm01_00165913 predicted 588
10 SASI_Mm02_00311594 predicted 951
11 SASI_Mm01_00165906 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007434
VALIDATED
AKT2 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-368s21c1
Sequence:CCGGCGACCCAACACCTTTGTCATACTCGAGTATGACAAAGGTGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1232s21c1
Sequence:CCGGCGCCTCTTTGAGCTCATTCTTCTCGAGAAGAATGAGCTCAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007434.3-603s21c1
Sequence:CCGGTGACCATGAATGACTTCGATTCTCGAGAATCGAAGTCATTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1452s21c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-232s21c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1266s1c1
Sequence:CCGGGCTCATTCTTATGGAGGAGATCTCGAGATCTCCTCCATAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-616s1c1
Sequence:CCGGCGGGCCAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-280s1c1
Sequence:CCGGGATGGATCTTTCATTGGGTATCTCGAGATACCCAATGAAAGATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1401s1c1
Sequence:CCGGGCATAGATTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAATCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-255s1c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1475s1c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-222s1c1
Sequence:CCGGCCACAAACGTGGTGAATACATCTCGAGATGTATTCACCACGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007434
VALIDATED
AKT2 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-368s21c1
Sequence:CCGGCGACCCAACACCTTTGTCATACTCGAGTATGACAAAGGTGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1232s21c1
Sequence:CCGGCGCCTCTTTGAGCTCATTCTTCTCGAGAAGAATGAGCTCAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007434.3-603s21c1
Sequence:CCGGTGACCATGAATGACTTCGATTCTCGAGAATCGAAGTCATTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1452s21c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-232s21c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1266s1c1
Sequence:CCGGGCTCATTCTTATGGAGGAGATCTCGAGATCTCCTCCATAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-616s1c1
Sequence:CCGGCGGGCCAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-280s1c1
Sequence:CCGGGATGGATCTTTCATTGGGTATCTCGAGATACCCAATGAAAGATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1401s1c1
Sequence:CCGGGCATAGATTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAATCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-255s1c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1475s1c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-222s1c1
Sequence:CCGGCCACAAACGTGGTGAATACATCTCGAGATGTATTCACCACGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007434
VALIDATED
AKT2 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-368s21c1
Sequence:CCGGCGACCCAACACCTTTGTCATACTCGAGTATGACAAAGGTGTTGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1232s21c1
Sequence:CCGGCGCCTCTTTGAGCTCATTCTTCTCGAGAAGAATGAGCTCAAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007434.3-603s21c1
Sequence:CCGGTGACCATGAATGACTTCGATTCTCGAGAATCGAAGTCATTCATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-1452s21c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007434.3-232s21c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1266s1c1
Sequence:CCGGGCTCATTCTTATGGAGGAGATCTCGAGATCTCCTCCATAAGAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-616s1c1
Sequence:CCGGCGGGCCAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-280s1c1
Sequence:CCGGGATGGATCTTTCATTGGGTATCTCGAGATACCCAATGAAAGATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1401s1c1
Sequence:CCGGGCATAGATTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAATCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-255s1c1
Sequence:CCGGGCCACGGTACTTCCTTCTGAACTCGAGTTCAGAAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-1475s1c1
Sequence:CCGGTCACTTCAGAAGTGGACACAACTCGAGTTGTGTCCACTTCTGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007434.2-222s1c1
Sequence:CCGGCCACAAACGTGGTGAATACATCTCGAGATGTATTCACCACGTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001626
VALIDATED
AKT2 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 2
Human
25 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-4181s21c1
Sequence:CCGGAGTCTACCCTGGTGGTCATAACTCGAGTTATGACCACCAGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-468s21c1
Sequence:CCGGGACCCAACACCTTTGTCATACCTCGAGGTATGACAAAGGTGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-810s21c1
Sequence:CCGGTGCGGAAGGAAGTCATCATTGCTCGAGCAATGATGACTTCCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-371s1c1
Sequence:CCGGCGTAGCAGAATGCCAGCTGATCTCGAGATCAGCTGGCATTCTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1071s21c1
Sequence:CCGGACGTGGTATACCGCGACATCACTCGAGTGATGTCGCGGTATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-894s21c1
Sequence:CCGGTCCTCACTGCGCTGAAGTATGCTCGAGCATACTTCAGCGCAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-518s21c1
Sequence:CCGGAGGACCTTCCACGTGGATTCTCTCGAGAGAATCCACGTGGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001626.3-4971s21c1
Sequence:CCGGCAAATGGACACGGCATCATAACTCGAGTTATGATGCCGTGTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1591s21c1
Sequence:CCGGTACCGCCCAGTCCATCACAATCTCGAGATTGTGATGGACTGGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-303s21c1
Sequence:CCGGAGCGTGGTGAATACATCAAGACTCGAGTCTTGATGTATTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-358s21c1
Sequence:CCGGCGGCTCCTTCATTGGGTACAACTCGAGTTGTACCCAATGAAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-1510s1c1
Sequence:CCGGCAAGGTACTTCGATGATGAATCTCGAGATTCATCATCGAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.x-354s1c1
Sequence:CCGGCCCTTAAACAACTTCTCCGTACTCGAGTACGGAGAAGTTGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-632s1c1
Sequence:CCGGACGGGCTAAAGTGACCATGAACTCGAGTTCATGGTCACTTTAGCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-355s1c1
Sequence:CCGGCCTTAAACAACTTCTCCGTAGCTCGAGCTACGGAGAAGTTGTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-656s1c1
Sequence:CCGGCTTCGACTATCTCAAACTCCTCTCGAGAGGAGTTTGAGATAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-633s1c1
Sequence:CCGGCGGGCTAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-272s1c1
Sequence:CCGGGCCACGGTACTTCCTGCTGAACTCGAGTTCAGCAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-1418s1c1
Sequence:CCGGGCACAGGTTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c1
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-749s1c1
Sequence:CCGGCCTGCGAAAGGAAGTCATCATCTCGAGATGATGACTTCCTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.2-1509s1c1
Sequence:CCGGACAAGGTACTTCGATGATGAACTCGAGTTCATCATCGAAGTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c2
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-737s1c1
Sequence:CCGGCGCCATGAAGATCCTGCGAAACTCGAGTTTCGCAGGATCTTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-832s1c1
Sequence:CCGGCGTTCCTCACTGCGCTGAAGTCTCGAGACTTCAGCGCAGTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001626
VALIDATED
AKT2 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 2
Human
25 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-4181s21c1
Sequence:CCGGAGTCTACCCTGGTGGTCATAACTCGAGTTATGACCACCAGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-468s21c1
Sequence:CCGGGACCCAACACCTTTGTCATACCTCGAGGTATGACAAAGGTGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-810s21c1
Sequence:CCGGTGCGGAAGGAAGTCATCATTGCTCGAGCAATGATGACTTCCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-371s1c1
Sequence:CCGGCGTAGCAGAATGCCAGCTGATCTCGAGATCAGCTGGCATTCTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1071s21c1
Sequence:CCGGACGTGGTATACCGCGACATCACTCGAGTGATGTCGCGGTATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-894s21c1
Sequence:CCGGTCCTCACTGCGCTGAAGTATGCTCGAGCATACTTCAGCGCAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-518s21c1
Sequence:CCGGAGGACCTTCCACGTGGATTCTCTCGAGAGAATCCACGTGGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001626.3-4971s21c1
Sequence:CCGGCAAATGGACACGGCATCATAACTCGAGTTATGATGCCGTGTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1591s21c1
Sequence:CCGGTACCGCCCAGTCCATCACAATCTCGAGATTGTGATGGACTGGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-303s21c1
Sequence:CCGGAGCGTGGTGAATACATCAAGACTCGAGTCTTGATGTATTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-358s21c1
Sequence:CCGGCGGCTCCTTCATTGGGTACAACTCGAGTTGTACCCAATGAAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-1510s1c1
Sequence:CCGGCAAGGTACTTCGATGATGAATCTCGAGATTCATCATCGAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.x-354s1c1
Sequence:CCGGCCCTTAAACAACTTCTCCGTACTCGAGTACGGAGAAGTTGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-632s1c1
Sequence:CCGGACGGGCTAAAGTGACCATGAACTCGAGTTCATGGTCACTTTAGCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-355s1c1
Sequence:CCGGCCTTAAACAACTTCTCCGTAGCTCGAGCTACGGAGAAGTTGTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-656s1c1
Sequence:CCGGCTTCGACTATCTCAAACTCCTCTCGAGAGGAGTTTGAGATAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-633s1c1
Sequence:CCGGCGGGCTAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-272s1c1
Sequence:CCGGGCCACGGTACTTCCTGCTGAACTCGAGTTCAGCAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-1418s1c1
Sequence:CCGGGCACAGGTTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c1
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-749s1c1
Sequence:CCGGCCTGCGAAAGGAAGTCATCATCTCGAGATGATGACTTCCTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.2-1509s1c1
Sequence:CCGGACAAGGTACTTCGATGATGAACTCGAGTTCATCATCGAAGTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c2
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-737s1c1
Sequence:CCGGCGCCATGAAGATCCTGCGAAACTCGAGTTTCGCAGGATCTTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-832s1c1
Sequence:CCGGCGTTCCTCACTGCGCTGAAGTCTCGAGACTTCAGCGCAGTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001626
VALIDATED
AKT2 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 2
Human
25 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-4181s21c1
Sequence:CCGGAGTCTACCCTGGTGGTCATAACTCGAGTTATGACCACCAGGGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-468s21c1
Sequence:CCGGGACCCAACACCTTTGTCATACCTCGAGGTATGACAAAGGTGTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-810s21c1
Sequence:CCGGTGCGGAAGGAAGTCATCATTGCTCGAGCAATGATGACTTCCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-371s1c1
Sequence:CCGGCGTAGCAGAATGCCAGCTGATCTCGAGATCAGCTGGCATTCTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1071s21c1
Sequence:CCGGACGTGGTATACCGCGACATCACTCGAGTGATGTCGCGGTATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-894s21c1
Sequence:CCGGTCCTCACTGCGCTGAAGTATGCTCGAGCATACTTCAGCGCAGTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-518s21c1
Sequence:CCGGAGGACCTTCCACGTGGATTCTCTCGAGAGAATCCACGTGGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001626.3-4971s21c1
Sequence:CCGGCAAATGGACACGGCATCATAACTCGAGTTATGATGCCGTGTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-1591s21c1
Sequence:CCGGTACCGCCCAGTCCATCACAATCTCGAGATTGTGATGGACTGGGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-303s21c1
Sequence:CCGGAGCGTGGTGAATACATCAAGACTCGAGTCTTGATGTATTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001626.3-358s21c1
Sequence:CCGGCGGCTCCTTCATTGGGTACAACTCGAGTTGTACCCAATGAAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-1510s1c1
Sequence:CCGGCAAGGTACTTCGATGATGAATCTCGAGATTCATCATCGAAGTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.x-354s1c1
Sequence:CCGGCCCTTAAACAACTTCTCCGTACTCGAGTACGGAGAAGTTGTTTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-632s1c1
Sequence:CCGGACGGGCTAAAGTGACCATGAACTCGAGTTCATGGTCACTTTAGCCCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-355s1c1
Sequence:CCGGCCTTAAACAACTTCTCCGTAGCTCGAGCTACGGAGAAGTTGTTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-656s1c1
Sequence:CCGGCTTCGACTATCTCAAACTCCTCTCGAGAGGAGTTTGAGATAGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.x-633s1c1
Sequence:CCGGCGGGCTAAAGTGACCATGAATCTCGAGATTCATGGTCACTTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-272s1c1
Sequence:CCGGGCCACGGTACTTCCTGCTGAACTCGAGTTCAGCAGGAAGTACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-1418s1c1
Sequence:CCGGGCACAGGTTCTTCCTCAGCATCTCGAGATGCTGAGGAAGAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c1
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-749s1c1
Sequence:CCGGCCTGCGAAAGGAAGTCATCATCTCGAGATGATGACTTCCTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001626.2-1509s1c1
Sequence:CCGGACAAGGTACTTCGATGATGAACTCGAGTTCATCATCGAAGTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001626.2-972s1c2
Sequence:CCGGGCAGAGATTGTCTCGGCTCTTCTCGAGAAGAGCCGAGACAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-737s1c1
Sequence:CCGGCGCCATGAAGATCCTGCGAAACTCGAGTTTCGCAGGATCTTCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001626.2-832s1c1
Sequence:CCGGCGTTCCTCACTGCGCTGAAGTCTCGAGACTTCAGCGCAGTGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks