EMAIL THIS PAGE TO A FRIEND

AKT3

v-akt murine thymoma viral oncogene homolog 3

280 Gene Product Result for
Synonyms: MPPH PKB-GAMMA PKBG PRKBG RAC-PK-gamma RAC-gamma STK-2
UniProtKB ID: Q9Y243, Q0VAA6, Q5VTI1, Q5VTI2, Q96QV3, Q9UFP5
Gene ID:
Human(10000) Summary: The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(23797) thymoma viral proto-oncogene 3
Rat(29414) v-akt murine thymoma viral oncogene homolog 3
Zebrafish(100149794) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
chicken(421497) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
cow(100137872) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
Horse(100054961) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
domestic cat(101092818) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
dog(442964) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
naked mole-rat(101701289) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
domestic guinea pig(100724315) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
sheep(101118462) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
Domestic Rabbit(100353706) v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300574 Anti-AKT1/AKT2/AKT3 (Ab-315/316/312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
A4982 Anti-AKT3 (119-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A5107 Anti-AKT3 (401-415) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW22777 Anti-AKT3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB2500056 Anti-AKT3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB2701912 Anti-akt3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
HPA026441 Anti-AKT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4504603 Anti-phospho-AKT1/3 (pTyr437/434) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300259 Anti-phospho-AKT1/AKT2/AKT3 (pTyr315/pTyr316/pTyr312) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0010000M2 Monoclonal Anti-AKT3 antibody produced in mouse clone 6E10, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB4100001 Monoclonal Anti-AKT3 antibody produced in mouse clone AKT3-A1, culture supernatant human
western blot pricing
SAB1404769 Monoclonal Anti-AKT3 antibody produced in mouse clone 6E11, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB3701467 Monoclonal Anti-Anti-AKT3 antibody produced in mouse clone 25F6.F6.D8, purified immunoglobulin human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005465 Rosetta Predictions human pricing
NM_181690 Rosetta Predictions human pricing
NM_031575 Rosetta Predictions rat pricing
NM_011785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122808 predicted 871
2 SASI_Hs01_00122809 predicted 269
3 SASI_Hs01_00122810 predicted 663
4 SASI_Hs01_00122812 predicted 288
5 SASI_Hs01_00122813 predicted 616
6 SASI_Hs02_00339628 predicted 599
7 SASI_Hs01_00122814 predicted 1161
8 SASI_Hs01_00122816 predicted 380
9 SASI_Hs01_00122817 predicted 1029
10 SASI_Hs02_00339629 predicted 427
11 SASI_Hs01_00122811 predicted 322
12 SASI_Hs01_00122815 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023201 predicted 870
2 SASI_Hs01_00023202 predicted 272
3 SASI_Hs01_00023203 predicted 668
4 SASI_Hs01_00023205 predicted 292
5 SASI_Hs01_00023206 predicted 616
6 SASI_Hs02_00370287 predicted 596
7 SASI_Hs01_00023207 predicted 1164
8 SASI_Hs01_00023209 predicted 380
9 SASI_Hs01_00023210 predicted 1025
10 SASI_Hs02_00370288 predicted 428
11 SASI_Hs01_00023204 predicted 320
12 SASI_Hs01_00023208 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112641 predicted 1173
2 SASI_Rn01_00112642 predicted 284
3 SASI_Rn01_00112644 predicted 653
4 SASI_Rn01_00112645 predicted 567
5 SASI_Rn01_00112646 predicted 878
6 SASI_Rn01_00112647 predicted 834
7 SASI_Rn01_00112648 predicted 1181
8 SASI_Rn02_00264837 predicted 317
9 SASI_Rn01_00112649 predicted 970
10 SASI_Rn01_00112650 predicted 445
11 SASI_Rn01_00112643 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200790 predicted 278
2 SASI_Mm01_00200791 predicted 806
3 SASI_Mm01_00200798 predicted 411
4 SASI_Mm01_00200792 predicted 675
5 SASI_Mm01_00200793 predicted 870
6 SASI_Mm01_00200794 predicted 1519
7 SASI_Mm01_00200795 predicted 835
8 SASI_Mm01_00200796 predicted 950
9 SASI_Mm01_00200797 predicted 464
10 SASI_Mm02_00321435 predicted 847
11 SASI_Mm01_00200799 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005465
VALIDATED
AKT3 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 3
Human
23 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1012s1c2
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-3142s1c1
Sequence:CCGGCCTCATCTTTCTCCTTCATTACTCGAGTAATGAAGGAGAAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-280s1c1
Sequence:CCGGCCAAAGCCAAACACATTTATACTCGAGTATAAATGTGTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1364s1c1
Sequence:CCGGCTGAGACAGATACTAGATATTCTCGAGAATATCTAGTATCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-671s1c1
Sequence:CCGGGCAGAGTATTAAAGAACACTACTCGAGTAGTGTTCTTTAATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1024s1c1
Sequence:CCGGCCAGAGGTGTTAGAAGATAATCTCGAGATTATCTTCTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1449s1c1
Sequence:CCGGCATTCTGCTACTTCACTGTCACTCGAGTGACAGTGAAGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1012s1c1
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-403s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-569s1c1
Sequence:CCGGTGGCACACACTCTAACTGAAACTCGAGTTTCAGTTAGAGTGTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-200s1c1
Sequence:CCGGAGAAACCTCAAGATGTGGATTCTCGAGAATCCACATCTTGAGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-361s1c1
Sequence:CCGGGAAAGGGAAGAATGGACAGAACTCGAGTTCTGTCCATTCTTCCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1307s1c1
Sequence:CCGGACTGGCAAGATGTATATGATACTCGAGTATCATATACATCTTGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-484s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1757s1c1
Sequence:CCGGGCTGCTACTGTCTTACTATTACTCGAGTAATAGTAAGACAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-770s1c1
Sequence:CCGGCTGCCTTGGACTATCTACATTCTCGAGAATGTAGATAGTCCAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1222s1c1
Sequence:CCGGGTAAACTGGCAAGATGTATATCTCGAGATATACATCTTGCCAGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-211s1c1
Sequence:CCGGGATGTGGATTTACCTTATCCCCTCGAGGGGATAAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-437s1c1
Sequence:CCGGGTAGTCCAACTTCACAAATTGCTCGAGCAATTTGTGAAGTTGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005465.3-2101s1c1
Sequence:CCGGGAACAACTGTTGGGATATATACTCGAGTATATATCCCAACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005465.3-1500s1c1
Sequence:CCGGCTCTGCAAGTGGACGAGAATACTCGAGTATTCTCGTCCACTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-2995s1c1
Sequence:CCGGCTTGGGATCATGGTACATTTACTCGAGTAAATGTACCATGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1165s1c1
Sequence:CCGGGACATTAAATTTCCTCGAACACTCGAGTGTTCGAGGAAATTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005465
VALIDATED
AKT3 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 3
Human
23 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1012s1c2
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-3142s1c1
Sequence:CCGGCCTCATCTTTCTCCTTCATTACTCGAGTAATGAAGGAGAAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-280s1c1
Sequence:CCGGCCAAAGCCAAACACATTTATACTCGAGTATAAATGTGTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1364s1c1
Sequence:CCGGCTGAGACAGATACTAGATATTCTCGAGAATATCTAGTATCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-671s1c1
Sequence:CCGGGCAGAGTATTAAAGAACACTACTCGAGTAGTGTTCTTTAATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1024s1c1
Sequence:CCGGCCAGAGGTGTTAGAAGATAATCTCGAGATTATCTTCTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1449s1c1
Sequence:CCGGCATTCTGCTACTTCACTGTCACTCGAGTGACAGTGAAGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1012s1c1
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-403s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-569s1c1
Sequence:CCGGTGGCACACACTCTAACTGAAACTCGAGTTTCAGTTAGAGTGTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-200s1c1
Sequence:CCGGAGAAACCTCAAGATGTGGATTCTCGAGAATCCACATCTTGAGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-361s1c1
Sequence:CCGGGAAAGGGAAGAATGGACAGAACTCGAGTTCTGTCCATTCTTCCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1307s1c1
Sequence:CCGGACTGGCAAGATGTATATGATACTCGAGTATCATATACATCTTGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-484s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1757s1c1
Sequence:CCGGGCTGCTACTGTCTTACTATTACTCGAGTAATAGTAAGACAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-770s1c1
Sequence:CCGGCTGCCTTGGACTATCTACATTCTCGAGAATGTAGATAGTCCAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1222s1c1
Sequence:CCGGGTAAACTGGCAAGATGTATATCTCGAGATATACATCTTGCCAGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-211s1c1
Sequence:CCGGGATGTGGATTTACCTTATCCCCTCGAGGGGATAAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-437s1c1
Sequence:CCGGGTAGTCCAACTTCACAAATTGCTCGAGCAATTTGTGAAGTTGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005465.3-2101s1c1
Sequence:CCGGGAACAACTGTTGGGATATATACTCGAGTATATATCCCAACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005465.3-1500s1c1
Sequence:CCGGCTCTGCAAGTGGACGAGAATACTCGAGTATTCTCGTCCACTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-2995s1c1
Sequence:CCGGCTTGGGATCATGGTACATTTACTCGAGTAAATGTACCATGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1165s1c1
Sequence:CCGGGACATTAAATTTCCTCGAACACTCGAGTGTTCGAGGAAATTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005465
VALIDATED
AKT3 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 3
Human
23 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1012s1c2
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-3142s1c1
Sequence:CCGGCCTCATCTTTCTCCTTCATTACTCGAGTAATGAAGGAGAAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-280s1c1
Sequence:CCGGCCAAAGCCAAACACATTTATACTCGAGTATAAATGTGTTTGGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1364s1c1
Sequence:CCGGCTGAGACAGATACTAGATATTCTCGAGAATATCTAGTATCTGTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-671s1c1
Sequence:CCGGGCAGAGTATTAAAGAACACTACTCGAGTAGTGTTCTTTAATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1024s1c1
Sequence:CCGGCCAGAGGTGTTAGAAGATAATCTCGAGATTATCTTCTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1449s1c1
Sequence:CCGGCATTCTGCTACTTCACTGTCACTCGAGTGACAGTGAAGTAGCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1012s1c1
Sequence:CCGGAAATGATGTGTGGGAGGTTACTCGAGTAACCTCCCACACATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-403s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-569s1c1
Sequence:CCGGTGGCACACACTCTAACTGAAACTCGAGTTTCAGTTAGAGTGTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-200s1c1
Sequence:CCGGAGAAACCTCAAGATGTGGATTCTCGAGAATCCACATCTTGAGGTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.x-361s1c1
Sequence:CCGGGAAAGGGAAGAATGGACAGAACTCGAGTTCTGTCCATTCTTCCCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005465.x-1307s1c1
Sequence:CCGGACTGGCAAGATGTATATGATACTCGAGTATCATATACATCTTGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-484s1c1
Sequence:CCGGGCCTCTACAACCCATCATAAACTCGAGTTTATGATGGGTTGTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1757s1c1
Sequence:CCGGGCTGCTACTGTCTTACTATTACTCGAGTAATAGTAAGACAGTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-770s1c1
Sequence:CCGGCTGCCTTGGACTATCTACATTCTCGAGAATGTAGATAGTCCAAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005465.x-1222s1c1
Sequence:CCGGGTAAACTGGCAAGATGTATATCTCGAGATATACATCTTGCCAGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-211s1c1
Sequence:CCGGGATGTGGATTTACCTTATCCCCTCGAGGGGATAAGGTAAATCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-437s1c1
Sequence:CCGGGTAGTCCAACTTCACAAATTGCTCGAGCAATTTGTGAAGTTGGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005465.3-2101s1c1
Sequence:CCGGGAACAACTGTTGGGATATATACTCGAGTATATATCCCAACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005465.3-1500s1c1
Sequence:CCGGCTCTGCAAGTGGACGAGAATACTCGAGTATTCTCGTCCACTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-2995s1c1
Sequence:CCGGCTTGGGATCATGGTACATTTACTCGAGTAAATGTACCATGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005465.3-1165s1c1
Sequence:CCGGGACATTAAATTTCCTCGAACACTCGAGTGTTCGAGGAAATTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011785
VALIDATED
AKT3 MISSION shRNA Bacterial Glycerol Stock
v-akt murine thymoma viral oncogene homolog 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1326s1c1
Sequence:CCGGCATCTGAAACAGACACCCGATCTCGAGATCGGGTGTCTGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011785.2-565s1c1
Sequence:CCGGCTATGCTATGAAGATTCTGAACTCGAGTTCAGAATCTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-853s1c1
Sequence:CCGGCCGTGATCTCAAGTTGGAGAACTCGAGTTCTCCAACTTGAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1365s1c1
Sequence:CCGGCAGCTCAGACTATTACAATAACTCGAGTTATTGTAATAGTCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-285s1c1
Sequence:CCGGCCACTGTTATAGAGAGAACATCTCGAGATGTTCTCTCTATAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1183s1c1
Sequence:CCGGGCTCTTGATAAAGGATCCAAACTCGAGTTTGGATCCTTTATCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-140s1c1
Sequence:CCGGGATGGCTCATTCATAGGCTATCTCGAGATAGCCTATGAATGAGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-406s21c1
Sequence:CCGGCCCAACCTCACAGATTGATAACTCGAGTTATCAATCTGTGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1330s21c1
Sequence:CCGGTGAAACAGACACCCGATATTTCTCGAGAAATATCGGGTGTCTGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011785.3-1719s21c1
Sequence:CCGGGCTACTGTCTTACTATTATAGCTCGAGCTATAATAGTAAGACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1466s21c1
Sequence:CCGGTCTGCAAGCGGACGGGAATAACTCGAGTTATTCCCGTCCGCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-448s21c1
Sequence:CCGGTGCGTCTACAACCCATCATAACTCGAGTTATGATGGGTTGTAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-142s21c1
Sequence:CCGGTGGCTCATTCATAGGCTATAACTCGAGTTATAGCCTATGAATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011785
VALIDATED
AKT3 MISSION shRNA shRNA Plasmid DNA
v-akt murine thymoma viral oncogene homolog 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1326s1c1
Sequence:CCGGCATCTGAAACAGACACCCGATCTCGAGATCGGGTGTCTGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011785.2-565s1c1
Sequence:CCGGCTATGCTATGAAGATTCTGAACTCGAGTTCAGAATCTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-853s1c1
Sequence:CCGGCCGTGATCTCAAGTTGGAGAACTCGAGTTCTCCAACTTGAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1365s1c1
Sequence:CCGGCAGCTCAGACTATTACAATAACTCGAGTTATTGTAATAGTCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-285s1c1
Sequence:CCGGCCACTGTTATAGAGAGAACATCTCGAGATGTTCTCTCTATAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1183s1c1
Sequence:CCGGGCTCTTGATAAAGGATCCAAACTCGAGTTTGGATCCTTTATCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-140s1c1
Sequence:CCGGGATGGCTCATTCATAGGCTATCTCGAGATAGCCTATGAATGAGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-406s21c1
Sequence:CCGGCCCAACCTCACAGATTGATAACTCGAGTTATCAATCTGTGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1330s21c1
Sequence:CCGGTGAAACAGACACCCGATATTTCTCGAGAAATATCGGGTGTCTGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011785.3-1719s21c1
Sequence:CCGGGCTACTGTCTTACTATTATAGCTCGAGCTATAATAGTAAGACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1466s21c1
Sequence:CCGGTCTGCAAGCGGACGGGAATAACTCGAGTTATTCCCGTCCGCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-448s21c1
Sequence:CCGGTGCGTCTACAACCCATCATAACTCGAGTTATGATGGGTTGTAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-142s21c1
Sequence:CCGGTGGCTCATTCATAGGCTATAACTCGAGTTATAGCCTATGAATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011785
VALIDATED
AKT3 MISSION shRNA Lentiviral Transduction Particles
v-akt murine thymoma viral oncogene homolog 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1326s1c1
Sequence:CCGGCATCTGAAACAGACACCCGATCTCGAGATCGGGTGTCTGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011785.2-565s1c1
Sequence:CCGGCTATGCTATGAAGATTCTGAACTCGAGTTCAGAATCTTCATAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-853s1c1
Sequence:CCGGCCGTGATCTCAAGTTGGAGAACTCGAGTTCTCCAACTTGAGATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1365s1c1
Sequence:CCGGCAGCTCAGACTATTACAATAACTCGAGTTATTGTAATAGTCTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-285s1c1
Sequence:CCGGCCACTGTTATAGAGAGAACATCTCGAGATGTTCTCTCTATAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-1183s1c1
Sequence:CCGGGCTCTTGATAAAGGATCCAAACTCGAGTTTGGATCCTTTATCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011785.2-140s1c1
Sequence:CCGGGATGGCTCATTCATAGGCTATCTCGAGATAGCCTATGAATGAGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-406s21c1
Sequence:CCGGCCCAACCTCACAGATTGATAACTCGAGTTATCAATCTGTGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1330s21c1
Sequence:CCGGTGAAACAGACACCCGATATTTCTCGAGAAATATCGGGTGTCTGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011785.3-1719s21c1
Sequence:CCGGGCTACTGTCTTACTATTATAGCTCGAGCTATAATAGTAAGACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-1466s21c1
Sequence:CCGGTCTGCAAGCGGACGGGAATAACTCGAGTTATTCCCGTCCGCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-448s21c1
Sequence:CCGGTGCGTCTACAACCCATCATAACTCGAGTTATGATGGGTTGTAGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011785.3-142s21c1
Sequence:CCGGTGGCTCATTCATAGGCTATAACTCGAGTTATAGCCTATGAATGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks