EMAIL THIS PAGE TO A FRIEND

AKTIP

AKT interacting protein

153 Gene Product Result for
Synonyms: FT1 FTS
UniProtKB ID: Q9H8T0, Q503B1, Q53H38
Gene ID:
Human(64400) Summary: The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(14339) thymoma viral proto-oncogene 1 interacting protein
Rat(291906) AKT interacting protein
Zebrafish(378716) akt interacting protein
cow(540462) AKT interacting protein
domestic cat(101095626) AKT interacting protein
dog(478126) AKT interacting protein
chicken(415720) AKT interacting protein
sheep(101114547) AKT interacting protein
domestic guinea pig(100715546) AKT interacting protein
naked mole-rat(101700642) AKT interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012398 Rosetta Predictions human pricing
NM_022476 Rosetta Predictions human pricing
NM_001011926 Rosetta Predictions rat pricing
XM_574209 Rosetta Predictions rat pricing
NM_010241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086240 predicted 586
2 SASI_Hs01_00086241 predicted 450
3 SASI_Hs01_00086242 predicted 566
4 SASI_Hs01_00086244 predicted 719
5 SASI_Hs01_00086245 predicted 1039
6 SASI_Hs01_00086246 predicted 431
7 SASI_Hs01_00086247 predicted 624
8 SASI_Hs01_00086248 predicted 549
9 SASI_Hs01_00086249 predicted 1093
10 SASI_Hs02_00306089 predicted 1132
11 SASI_Hs01_00086243 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012914 predicted 552
2 SASI_Hs01_00012915 predicted 416
3 SASI_Hs01_00012916 predicted 534
4 SASI_Hs01_00012918 predicted 689
5 SASI_Hs01_00012919 predicted 1008
6 SASI_Hs01_00012920 predicted 402
7 SASI_Hs01_00012921 predicted 595
8 SASI_Hs01_00012922 predicted 521
9 SASI_Hs01_00012923 predicted 1068
10 SASI_Hs02_00355756 predicted 1106
11 SASI_Hs01_00012917 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037255 predicted 591
2 SASI_Rn01_00037256 predicted 826
3 SASI_Rn01_00037257 predicted 674
4 SASI_Rn01_00037258 predicted 527
5 SASI_Rn01_00037259 predicted 369
6 SASI_Rn01_00037260 predicted 441
7 SASI_Rn02_00199928 predicted 1023
8 SASI_Rn01_00037261 predicted 511
9 SASI_Rn01_00037262 predicted 459
10 SASI_Rn01_00037264 predicted 576
11 SASI_Rn01_00037263 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137109 predicted 677
2 SASI_Rn01_00137110 predicted 456
3 SASI_Rn01_00137111 predicted 654
4 SASI_Rn01_00137112 predicted 605
5 SASI_Rn01_00137113 predicted 759
6 SASI_Rn01_00137114 predicted 459
7 SASI_Rn01_00137115 predicted 537
8 SASI_Rn01_00137116 predicted 766
9 SASI_Rn01_00137117 predicted 437
10 SASI_Rn01_00137118 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042355 predicted 868
2 SASI_Mm01_00042356 predicted 642
3 SASI_Mm01_00042358 predicted 430
4 SASI_Mm01_00042359 predicted 1083
5 SASI_Mm01_00042360 predicted 588
6 SASI_Mm02_00318113 predicted 723
7 SASI_Mm01_00042361 predicted 1139
8 SASI_Mm01_00042363 predicted 550
9 SASI_Mm01_00042362 predicted 982
10 SASI_Mm01_00042364 predicted 1030
11 SASI_Mm01_00042357 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010241
AKTIP MISSION shRNA Bacterial Glycerol Stock
AKT interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-634s21c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010241.4-1140s21c1
Sequence:CCGGCCTAGTTAAAGCTGACTAATGCTCGAGCATTAGTCAGCTTTAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-989s21c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-717s21c1
Sequence:CCGGGGCGGAACCATAACCATATATCTCGAGATATATGGTTATGGTTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-1058s21c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-633s1c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-1057s1c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-573s1c1
Sequence:CCGGCGTATTCAAGTTTACGGTGTACTCGAGTACACCGTAAACTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-514s1c1
Sequence:CCGGCGCTCTGCATTAGTGTGGTTTCTCGAGAAACCACACTAATGCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-988s1c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010241
AKTIP MISSION shRNA shRNA Plasmid DNA
AKT interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-634s21c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010241.4-1140s21c1
Sequence:CCGGCCTAGTTAAAGCTGACTAATGCTCGAGCATTAGTCAGCTTTAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-989s21c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-717s21c1
Sequence:CCGGGGCGGAACCATAACCATATATCTCGAGATATATGGTTATGGTTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-1058s21c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-633s1c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-1057s1c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-573s1c1
Sequence:CCGGCGTATTCAAGTTTACGGTGTACTCGAGTACACCGTAAACTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-514s1c1
Sequence:CCGGCGCTCTGCATTAGTGTGGTTTCTCGAGAAACCACACTAATGCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-988s1c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010241
AKTIP MISSION shRNA Lentiviral Transduction Particles
AKT interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-634s21c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010241.4-1140s21c1
Sequence:CCGGCCTAGTTAAAGCTGACTAATGCTCGAGCATTAGTCAGCTTTAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-989s21c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-717s21c1
Sequence:CCGGGGCGGAACCATAACCATATATCTCGAGATATATGGTTATGGTTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010241.4-1058s21c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-633s1c1
Sequence:CCGGGCTGTTTGATATTCCCGTCTTCTCGAGAAGACGGGAATATCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-1057s1c1
Sequence:CCGGCCTTTCAGTAAAGAAGAGAAACTCGAGTTTCTCTTCTTTACTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-573s1c1
Sequence:CCGGCGTATTCAAGTTTACGGTGTACTCGAGTACACCGTAAACTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-514s1c1
Sequence:CCGGCGCTCTGCATTAGTGTGGTTTCTCGAGAAACCACACTAATGCAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010241.1-988s1c1
Sequence:CCGGCCTGATGAACAGCACAATAAACTCGAGTTTATTGTGCTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022476
VALIDATED
AKTIP MISSION shRNA Bacterial Glycerol Stock
AKT interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-325s21c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-275s21c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-842s21c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-230s21c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022476.2-1223s21c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-211s1c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-306s1c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-256s1c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-823s1c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-1204s1c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022476
VALIDATED
AKTIP MISSION shRNA shRNA Plasmid DNA
AKT interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-325s21c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-275s21c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-842s21c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-230s21c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022476.2-1223s21c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-211s1c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-306s1c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-256s1c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-823s1c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-1204s1c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022476
VALIDATED
AKTIP MISSION shRNA Lentiviral Transduction Particles
AKT interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-325s21c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-275s21c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-842s21c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022476.2-230s21c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022476.2-1223s21c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-211s1c1
Sequence:CCGGTGAAGGTGAAGAGAAGACATTCTCGAGAATGTCTTCTCTTCACCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-306s1c1
Sequence:CCGGTGCCCATAACTAAGCCTACATCTCGAGATGTAGGCTTAGTTATGGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-256s1c1
Sequence:CCGGTCCACGAACTGCACCAAAGAACTCGAGTTCTTTGGTGCAGTTCGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-823s1c1
Sequence:CCGGCACTGCTCGTTTGTTTGACCACTCGAGTGGTCAAACAAACGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022476.x-1204s1c1
Sequence:CCGGCCTGTCTCTAAGTAATGCATTCTCGAGAATGCATTACTTAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks