EMAIL THIS PAGE TO A FRIEND

ALAD

aminolevulinate dehydratase

98 Gene Product Result for
Synonyms: ALADH PBGS
UniProtKB ID: P13716, A8K375, B2R6F2, Q16870, Q16871, Q9BVQ9
Gene ID:
Human(210) Summary: The ALAD enzyme is composed of 8 identical subunits and catalyzes the condensation of 2 molecules of delta-aminolevulinate to form porphobilinogen (a precursor of heme, cytochromes and other hemoproteins). ALAD catalyzes the second step in the porphyrin and heme biosynthetic pathway; zinc is essential for enzymatic activity. ALAD enzymatic activity is inhibited by lead and a defect in the ALAD structural gene can cause increased sensitivity to lead poisoning and acute hepatic porphyria. [provided by RefSeq, Jul 2008]
Mouse(17025) aminolevulinate, delta-, dehydratase
Rat(25374) aminolevulinate dehydratase
Zebrafish(550338) aminolevulinate dehydratase
chicken(417274) aminolevulinate dehydratase
cow(510679) aminolevulinate dehydratase
dog(474808) aminolevulinate dehydratase
domestic cat(101096680) aminolevulinate dehydratase
naked mole-rat(101701839) aminolevulinate dehydratase
domestic guinea pig(100733573) aminolevulinate dehydratase
sheep(101106393) aminolevulinate dehydratase
Domestic Rabbit(100356141) aminolevulinate dehydratase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000031 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000031 Rosetta Predictions human pricing
NM_001003945 Rosetta Predictions human pricing
NM_012899 Rosetta Predictions rat pricing
NM_008525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301703 predicted 1205
2 SASI_Hs01_00223304 predicted 1617
3 SASI_Hs01_00223307 predicted 1630
4 SASI_Hs02_00301704 predicted 493
5 SASI_Hs02_00301705 predicted 936
6 SASI_Hs01_00223309 predicted 1613
7 SASI_Hs01_00223311 predicted 789
8 SASI_Hs02_00301706 predicted 790
9 SASI_Hs02_00301707 predicted 1371
10 SASI_Hs02_00301708 predicted 828
11 SASI_Hs01_00223303 predicted 738
12 SASI_Hs01_00223305 predicted 931
13 SASI_Hs01_00223306 predicted 576
14 SASI_Hs01_00223308 predicted 1419
15 SASI_Hs01_00223310 predicted 609
16 SASI_Hs01_00223312 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152803 predicted 906
2 SASI_Hs01_00152804 predicted 1743
3 SASI_Hs01_00152805 predicted 1096
4 SASI_Hs01_00152806 predicted 742
5 SASI_Hs01_00152807 predicted 1753
6 SASI_Hs01_00152808 predicted 1586
7 SASI_Hs01_00152809 predicted 1733
8 SASI_Hs01_00152810 predicted 773
9 SASI_Hs01_00152811 predicted 913
10 SASI_Hs01_00152812 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046055 predicted 718
2 SASI_Rn01_00046056 predicted 250
3 SASI_Rn02_00260425 predicted 253
4 SASI_Rn01_00046057 predicted 897
5 SASI_Rn01_00046058 predicted 273
6 SASI_Rn02_00260426 predicted 637
7 SASI_Rn01_00046059 predicted 922
8 SASI_Rn01_00046060 predicted 318
9 SASI_Rn01_00046061 predicted 760
10 SASI_Rn01_00046062 predicted 742
11 SASI_Rn01_00046063 predicted 659
12 SASI_Rn01_00046064 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064391 predicted 837
2 SASI_Mm01_00064392 predicted 444
3 SASI_Mm01_00064393 predicted 758
4 SASI_Mm01_00064394 predicted 1010
5 SASI_Mm01_00064396 predicted 359
6 SASI_Mm01_00064397 predicted 853
7 SASI_Mm01_00064398 predicted 354
8 SASI_Mm01_00064399 predicted 383
9 SASI_Mm01_00064400 predicted 870
10 SASI_Mm02_00314111 predicted 369
11 SASI_Mm01_00064395 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000031
VALIDATED
ALAD MISSION shRNA Bacterial Glycerol Stock
aminolevulinate dehydratase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-1087s1c1
Sequence:CCGGTGACATCATCATCACCTACTACTCGAGTAGTAGGTGATGATGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-449s1c1
Sequence:CCGGCCAGCTATTGAGGCAATCCATCTCGAGATGGATTGCCTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000031.3-271s1c1
Sequence:CCGGTCCTGATGACATACAGCCTATCTCGAGATAGGCTGTATGTCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-466s1c1
Sequence:CCGGCCATCTGTTGAGGAAGACCTTCTCGAGAAGGTCTTCCTCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-730s1c1
Sequence:CCGGGATGAGCTACAGTGCCAAATTCTCGAGAATTTGGCACTGTAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-420s21c1
Sequence:CCGGTACGCTGTGTCTTGATCTTTGCTCGAGCAAAGATCAAGACACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-1729s21c1
Sequence:CCGGATTCTACTCTGAACCATAAACCTCGAGGTTTATGGTTCAGAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-783s21c1
Sequence:CCGGTGAGCTACAGTGCCAAATTTGCTCGAGCAAATTTGGCACTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-230s21c1
Sequence:CCGGGGCTACTTCCACCCACTACTTCTCGAGAAGTAGTGGGTGGAAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-315s21c1
Sequence:CCGGCGGATGTTCCTGATGACATACCTCGAGGTATGTCATCAGGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000031
VALIDATED
ALAD MISSION shRNA shRNA Plasmid DNA
aminolevulinate dehydratase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-1087s1c1
Sequence:CCGGTGACATCATCATCACCTACTACTCGAGTAGTAGGTGATGATGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-449s1c1
Sequence:CCGGCCAGCTATTGAGGCAATCCATCTCGAGATGGATTGCCTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000031.3-271s1c1
Sequence:CCGGTCCTGATGACATACAGCCTATCTCGAGATAGGCTGTATGTCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-466s1c1
Sequence:CCGGCCATCTGTTGAGGAAGACCTTCTCGAGAAGGTCTTCCTCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-730s1c1
Sequence:CCGGGATGAGCTACAGTGCCAAATTCTCGAGAATTTGGCACTGTAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-420s21c1
Sequence:CCGGTACGCTGTGTCTTGATCTTTGCTCGAGCAAAGATCAAGACACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-1729s21c1
Sequence:CCGGATTCTACTCTGAACCATAAACCTCGAGGTTTATGGTTCAGAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-783s21c1
Sequence:CCGGTGAGCTACAGTGCCAAATTTGCTCGAGCAAATTTGGCACTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-230s21c1
Sequence:CCGGGGCTACTTCCACCCACTACTTCTCGAGAAGTAGTGGGTGGAAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-315s21c1
Sequence:CCGGCGGATGTTCCTGATGACATACCTCGAGGTATGTCATCAGGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000031
VALIDATED
ALAD MISSION shRNA Lentiviral Transduction Particles
aminolevulinate dehydratase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-1087s1c1
Sequence:CCGGTGACATCATCATCACCTACTACTCGAGTAGTAGGTGATGATGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-449s1c1
Sequence:CCGGCCAGCTATTGAGGCAATCCATCTCGAGATGGATTGCCTCAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000031.3-271s1c1
Sequence:CCGGTCCTGATGACATACAGCCTATCTCGAGATAGGCTGTATGTCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-466s1c1
Sequence:CCGGCCATCTGTTGAGGAAGACCTTCTCGAGAAGGTCTTCCTCAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000031.3-730s1c1
Sequence:CCGGGATGAGCTACAGTGCCAAATTCTCGAGAATTTGGCACTGTAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-420s21c1
Sequence:CCGGTACGCTGTGTCTTGATCTTTGCTCGAGCAAAGATCAAGACACAGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-1729s21c1
Sequence:CCGGATTCTACTCTGAACCATAAACCTCGAGGTTTATGGTTCAGAGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-783s21c1
Sequence:CCGGTGAGCTACAGTGCCAAATTTGCTCGAGCAAATTTGGCACTGTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000031.5-230s21c1
Sequence:CCGGGGCTACTTCCACCCACTACTTCTCGAGAAGTAGTGGGTGGAAGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000031.5-315s21c1
Sequence:CCGGCGGATGTTCCTGATGACATACCTCGAGGTATGTCATCAGGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008525
VALIDATED
ALAD MISSION shRNA Bacterial Glycerol Stock
aminolevulinate dehydratase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-881s1c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-365s1c1
Sequence:CCGGCAACCTCATCTATCCCATCTTCTCGAGAAGATGGGATAGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-856s1c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-387s1c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-398s1c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-387s21c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-881s21c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-856s21c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-398s21c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008525
VALIDATED
ALAD MISSION shRNA shRNA Plasmid DNA
aminolevulinate dehydratase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-881s1c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-365s1c1
Sequence:CCGGCAACCTCATCTATCCCATCTTCTCGAGAAGATGGGATAGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-856s1c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-387s1c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-398s1c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-387s21c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-881s21c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-856s21c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-398s21c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008525
VALIDATED
ALAD MISSION shRNA Lentiviral Transduction Particles
aminolevulinate dehydratase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-881s1c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-365s1c1
Sequence:CCGGCAACCTCATCTATCCCATCTTCTCGAGAAGATGGGATAGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-856s1c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-387s1c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008525.3-398s1c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-387s21c1
Sequence:CCGGGTCACGGATGTTCCTGATGATCTCGAGATCATCAGGAACATCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-881s21c1
Sequence:CCGGCTCCTGTTTCTACGGTCCTTTCTCGAGAAAGGACCGTAGAAACAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-856s21c1
Sequence:CCGGTGATGAGCTATAGTGCCAAATCTCGAGATTTGGCACTATAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008525.3-398s21c1
Sequence:CCGGTCCTGATGATGTCCAGCCTATCTCGAGATAGGCTGGACATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks