EMAIL THIS PAGE TO A FRIEND

ALAS1

aminolevulinate, delta-, synthase 1

63 Gene Product Result for
Synonyms: ALAS ALAS3 ALASH MIG4
UniProtKB ID: P13196
Gene ID:
Human(211) Summary: This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Mouse(11655) aminolevulinic acid synthase 1
Rat(65155) aminolevulinate, delta-, synthase 1
Zebrafish(64608) aminolevulinate, delta-, synthetase 1
dog(476600) aminolevulinate, delta-, synthase 1
Horse(100060491) aminolevulinate, delta-, synthase 1
cow(534286) aminolevulinate, delta-, synthase 1
domestic cat(101080876) aminolevulinate, delta-, synthase 1
chicken(552895) aminolevulinate, delta-, synthase 1
naked mole-rat(101701151) aminolevulinate, delta-, synthase 1
domestic guinea pig(100723853) aminolevulinate, delta-, synthase 1
Goat(100861387) aminolevulinate, delta-, synthase 1
Domestic Rabbit(100345847) aminolevulinate, delta-, synthase 1
sheep(101112853) aminolevulinate, delta-, synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000688 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000688 Rosetta Predictions human pricing
NM_199166 Rosetta Predictions human pricing
NM_024484 Rosetta Predictions rat pricing
NM_020559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234698 predicted 1122
2 SASI_Hs01_00234700 predicted 1978
3 SASI_Hs01_00234701 predicted 1390
4 SASI_Hs01_00234702 predicted 2025
5 SASI_Hs02_00303090 predicted 993
6 SASI_Hs01_00234703 predicted 1860
7 SASI_Hs01_00234704 predicted 541
8 SASI_Hs01_00234705 predicted 1964
9 SASI_Hs01_00234706 predicted 1184
10 SASI_Hs01_00234707 predicted 2082
11 SASI_Hs01_00234699 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167942 predicted 973
2 SASI_Hs01_00167944 predicted 1834
3 SASI_Hs01_00167945 predicted 1242
4 SASI_Hs01_00167946 predicted 1881
5 SASI_Hs02_00372597 predicted 842
6 SASI_Hs01_00167947 predicted 1710
7 SASI_Hs01_00167948 predicted 387
8 SASI_Hs01_00167949 predicted 1821
9 SASI_Hs01_00167950 predicted 1041
10 SASI_Hs02_00372598 predicted 1932
11 SASI_Hs01_00167943 predicted 1327
12 SASI_Hs01_00167951 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071648 predicted 1149
2 SASI_Rn01_00071649 predicted 1740
3 SASI_Rn01_00071651 predicted 1831
4 SASI_Rn02_00264012 predicted 299
5 SASI_Rn02_00264013 predicted 1075
6 SASI_Rn01_00071652 predicted 248
7 SASI_Rn01_00071653 predicted 1231
8 SASI_Rn01_00071654 predicted 1299
9 SASI_Rn01_00071655 predicted 1000
10 SASI_Rn01_00071656 predicted 1035
11 SASI_Rn01_00071650 predicted 1194
12 SASI_Rn01_00071657 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180385 predicted 1504
2 SASI_Mm02_00325587 predicted 2067
3 SASI_Mm01_00180386 predicted 1838
4 SASI_Mm02_00325588 predicted 2173
5 SASI_Mm01_00180387 predicted 1151
6 SASI_Mm02_00325589 predicted 2143
7 SASI_Mm02_00325590 predicted 1271
8 SASI_Mm02_00325591 predicted 253
9 SASI_Mm01_00180392 predicted 1094
10 SASI_Mm01_00180393 predicted 1814
11 SASI_Mm01_00180388 predicted 1834
12 SASI_Mm01_00180389 predicted 300
13 SASI_Mm01_00180390 predicted 1080
14 SASI_Mm01_00180391 predicted 955
15 SASI_Mm01_00180394 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000688
VALIDATED
ALAS1 MISSION shRNA Bacterial Glycerol Stock
aminolevulinate, delta-, synthase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1384s21c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1463s21c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1130s21c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1323s21c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-872s21c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-872s1c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1323s1c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-1130s1c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1463s1c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1384s1c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000688
VALIDATED
ALAS1 MISSION shRNA shRNA Plasmid DNA
aminolevulinate, delta-, synthase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1384s21c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1463s21c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1130s21c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1323s21c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-872s21c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-872s1c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1323s1c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-1130s1c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1463s1c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1384s1c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000688
VALIDATED
ALAS1 MISSION shRNA Lentiviral Transduction Particles
aminolevulinate, delta-, synthase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1384s21c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1463s21c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1130s21c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-1323s21c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000688.4-872s21c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-872s1c1
Sequence:CCGGCCAGAAAGAGTGTCTCATCTTCTCGAGAAGATGAGACACTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1323s1c1
Sequence:CCGGGCTGTGAGATTTACTCTGATTCTCGAGAATCAGAGTAAATCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000688.4-1130s1c1
Sequence:CCGGGCAGTTATGGACACTTTGAAACTCGAGTTTCAAAGTGTCCATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1463s1c1
Sequence:CCGGCCCAAGATTGTGGCATTTGAACTCGAGTTCAAATGCCACAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000688.4-1384s1c1
Sequence:CCGGCCGAGTGCCAAAGTACATCTTCTCGAGAAGATGTACTTTGGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020559
VALIDATED
ALAS1 MISSION shRNA Bacterial Glycerol Stock
aminolevulinate, delta-, synthase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-2064s21c1
Sequence:CCGGGAAAGAGAGAAAGCCTATTTCCTCGAGGAAATAGGCTTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-930s21c1
Sequence:CCGGGTGTCGGTCTGGTGCAGTAATCTCGAGATTACTGCACCAGACCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-1833s21c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-1324s21c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1226s1c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1225s1c1
Sequence:CCGGCCCAAGATAGTAGCATTTGAACTCGAGTTCAAATGCTACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020559.1-1085s1c1
Sequence:CCGGGCTGTGAAATTTACTCTGATTCTCGAGAATCAGAGTAAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1729s1c1
Sequence:CCGGGATGAGTTGATGACCAGGCATCTCGAGATGCCTGGTCATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1732s1c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020559
VALIDATED
ALAS1 MISSION shRNA shRNA Plasmid DNA
aminolevulinate, delta-, synthase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-2064s21c1
Sequence:CCGGGAAAGAGAGAAAGCCTATTTCCTCGAGGAAATAGGCTTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-930s21c1
Sequence:CCGGGTGTCGGTCTGGTGCAGTAATCTCGAGATTACTGCACCAGACCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-1833s21c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-1324s21c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1226s1c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1225s1c1
Sequence:CCGGCCCAAGATAGTAGCATTTGAACTCGAGTTCAAATGCTACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020559.1-1085s1c1
Sequence:CCGGGCTGTGAAATTTACTCTGATTCTCGAGAATCAGAGTAAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1729s1c1
Sequence:CCGGGATGAGTTGATGACCAGGCATCTCGAGATGCCTGGTCATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1732s1c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020559
VALIDATED
ALAS1 MISSION shRNA Lentiviral Transduction Particles
aminolevulinate, delta-, synthase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-2064s21c1
Sequence:CCGGGAAAGAGAGAAAGCCTATTTCCTCGAGGAAATAGGCTTTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-930s21c1
Sequence:CCGGGTGTCGGTCTGGTGCAGTAATCTCGAGATTACTGCACCAGACCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020559.2-1833s21c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020559.2-1324s21c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1226s1c1
Sequence:CCGGCCAAGATAGTAGCATTTGAAACTCGAGTTTCAAATGCTACTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1225s1c1
Sequence:CCGGCCCAAGATAGTAGCATTTGAACTCGAGTTCAAATGCTACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020559.1-1085s1c1
Sequence:CCGGGCTGTGAAATTTACTCTGATTCTCGAGAATCAGAGTAAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1729s1c1
Sequence:CCGGGATGAGTTGATGACCAGGCATCTCGAGATGCCTGGTCATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020559.1-1732s1c1
Sequence:CCGGGAGTTGATGACCAGGCATAATCTCGAGATTATGCCTGGTCATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks