EMAIL THIS PAGE TO A FRIEND

ALAS2

aminolevulinate, delta-, synthase 2

108 Gene Product Result for
Synonyms: ALAS-E ALASE ANH1 ASB XLDPP XLEPP XLSA
UniProtKB ID: P22557, A8K3F0, A8K6C4, Q13735, Q8N6H3
Gene ID:
Human(212) Summary: The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(11656) aminolevulinic acid synthase 2, erythroid
Rat(25748) aminolevulinate, delta-, synthase 2
sheep(101115684) aminolevulinate, delta-, synthase 2
Domestic Rabbit(100345273) aminolevulinate, delta-, synthase 2
domestic guinea pig(100721933) aminolevulinate, delta-, synthase 2
naked mole-rat(101699592) aminolevulinate, delta-, synthase 2
Zebrafish(64607) aminolevulinate, delta-, synthetase 2
cow(511791) aminolevulinate, delta-, synthase 2
Horse(100060580) aminolevulinate, delta-, synthase 2
domestic cat(101095553) aminolevulinate, delta-, synthase 2
dog(491498) aminolevulinate, delta-, synthase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000032 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000032 Rosetta Predictions human pricing
NM_001037967 Rosetta Predictions human pricing
NM_001037968 Rosetta Predictions human pricing
NM_001037969 Rosetta Predictions human pricing
NM_013197 Rosetta Predictions rat pricing
NM_001102446 Rosetta Predictions mouse pricing
NM_009653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050354 predicted 1330
2 SASI_Hs01_00050355 predicted 1330
3 SASI_Hs01_00050357 predicted 1164
4 SASI_Hs01_00050358 predicted 1019
5 SASI_Hs01_00050359 predicted 904
6 SASI_Hs01_00050360 predicted 894
7 SASI_Hs01_00050361 predicted 812
8 SASI_Hs01_00050363 predicted 1169
9 SASI_Hs02_00301709 predicted 1181
10 SASI_Hs02_00301710 predicted 965
11 SASI_Hs01_00050356 predicted 959
12 SASI_Hs01_00050362 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194323 predicted 1216
2 SASI_Hs01_00194324 predicted 1214
3 SASI_Hs01_00194326 predicted 1060
4 SASI_Hs01_00194327 predicted 913
5 SASI_Hs01_00194328 predicted 789
6 SASI_Hs01_00194329 predicted 784
7 SASI_Hs01_00194330 predicted 707
8 SASI_Hs01_00194332 predicted 1054
9 SASI_Hs02_00308386 predicted 1070
10 SASI_Hs02_00308387 predicted 860
11 SASI_Hs01_00194325 predicted 857
12 SASI_Hs01_00194331 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127065 predicted 1329
2 SASI_Hs01_00127066 predicted 1328
3 SASI_Hs01_00127068 predicted 1169
4 SASI_Hs01_00127069 predicted 1019
5 SASI_Hs01_00127070 predicted 901
6 SASI_Hs01_00127071 predicted 895
7 SASI_Hs01_00127072 predicted 812
8 SASI_Hs01_00127074 predicted 1162
9 SASI_Hs02_00308388 predicted 1172
10 SASI_Hs02_00308389 predicted 966
11 SASI_Hs01_00127067 predicted 956
12 SASI_Hs01_00127073 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110630 predicted 1133
2 SASI_Hs01_00110631 predicted 1133
3 SASI_Hs01_00110633 predicted 969
4 SASI_Hs01_00110634 predicted 823
5 SASI_Hs01_00110635 predicted 710
6 SASI_Hs01_00110636 predicted 703
7 SASI_Hs01_00110637 predicted 618
8 SASI_Hs01_00110639 predicted 969
9 SASI_Hs02_00308390 predicted 981
10 SASI_Hs02_00308391 predicted 768
11 SASI_Hs01_00110632 predicted 769
12 SASI_Hs01_00110638 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059059 predicted 854
2 SASI_Rn02_00261068 predicted 506
3 SASI_Rn01_00059060 predicted 705
4 SASI_Rn01_00059062 predicted 711
5 SASI_Rn01_00059063 predicted 487
6 SASI_Rn01_00059064 predicted 1475
7 SASI_Rn01_00059065 predicted 794
8 SASI_Rn01_00059066 predicted 688
9 SASI_Rn01_00059067 predicted 290
10 SASI_Rn01_00059068 predicted 789
11 SASI_Rn01_00059061 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302853 predicted 881
2 SASI_Mm02_00302854 predicted 735
3 SASI_Mm02_00302855 predicted 531
4 SASI_Mm02_00302856 predicted 1046
5 SASI_Mm02_00302857 predicted 842
6 SASI_Mm02_00302858 predicted 611
7 SASI_Mm02_00302859 predicted 598
8 SASI_Mm02_00302860 predicted 592
9 SASI_Mm02_00302861 predicted 1095
10 SASI_Mm02_00302862 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020346 predicted 927
2 SASI_Mm01_00020348 predicted 774
3 SASI_Mm01_00020350 predicted 575
4 SASI_Mm02_00316652 predicted 1083
5 SASI_Mm01_00020352 predicted 890
6 SASI_Mm01_00020353 predicted 650
7 SASI_Mm01_00020354 predicted 650
8 SASI_Mm01_00020355 predicted 637
9 SASI_Mm02_00316653 predicted 1142
10 SASI_Mm02_00316654 predicted 796
11 SASI_Mm01_00020347 predicted 1210
12 SASI_Mm01_00020349 predicted 1520
13 SASI_Mm01_00020351 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009653
ALAS2 MISSION shRNA Bacterial Glycerol Stock
aminolevulinate, delta-, synthase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-837s1c1
Sequence:CCGGGCCAATGATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-445s1c1
Sequence:CCGGCCCACCTGATTCAGAACAATACTCGAGTATTGTTCTGAATCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1769s1c1
Sequence:CCGGGCGATCCTACTTTGGGAACATCTCGAGATGTTCCCAAAGTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-730s1c1
Sequence:CCGGGCACTCGCAATATCTCAGGTACTCGAGTACCTGAGATATTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1178s1c1
Sequence:CCGGGCGTGATGGAATTATGCACAACTCGAGTTGTGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009653
ALAS2 MISSION shRNA shRNA Plasmid DNA
aminolevulinate, delta-, synthase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-837s1c1
Sequence:CCGGGCCAATGATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-445s1c1
Sequence:CCGGCCCACCTGATTCAGAACAATACTCGAGTATTGTTCTGAATCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1769s1c1
Sequence:CCGGGCGATCCTACTTTGGGAACATCTCGAGATGTTCCCAAAGTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-730s1c1
Sequence:CCGGGCACTCGCAATATCTCAGGTACTCGAGTACCTGAGATATTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1178s1c1
Sequence:CCGGGCGTGATGGAATTATGCACAACTCGAGTTGTGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009653
ALAS2 MISSION shRNA Lentiviral Transduction Particles
aminolevulinate, delta-, synthase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-837s1c1
Sequence:CCGGGCCAATGATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-445s1c1
Sequence:CCGGCCCACCTGATTCAGAACAATACTCGAGTATTGTTCTGAATCAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1769s1c1
Sequence:CCGGGCGATCCTACTTTGGGAACATCTCGAGATGTTCCCAAAGTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-730s1c1
Sequence:CCGGGCACTCGCAATATCTCAGGTACTCGAGTACCTGAGATATTGCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009653.1-1178s1c1
Sequence:CCGGGCGTGATGGAATTATGCACAACTCGAGTTGTGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000032
ALAS2 MISSION shRNA Bacterial Glycerol Stock
aminolevulinate, delta-, synthase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1174s1c1
Sequence:CCGGGCGTGATGGAATTATGCATAACTCGAGTTATGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-628s1c1
Sequence:CCGGCGTCTGGTGTAGTAATGATTACTCGAGTAATCATTACTACACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-137s1c1
Sequence:CCGGCACCAGTTCCTGTTTGGTATTCTCGAGAATACCAAACAGGAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1627s1c1
Sequence:CCGGCCCTCAGATGATGGAAGATTTCTCGAGAAATCTTCCATCATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-538s1c1
Sequence:CCGGCCGTGTGTTCAAGACTGTGAACTCGAGTTCACAGTCTTGAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000032.4-1986s21c1
Sequence:CCGGTCTAGCTGAATTGAGCCTAAACTCGAGTTTAGGCTCAATTCAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000032.4-660s21c1
Sequence:CCGGATATCCCTTTGCCCAACATTTCTCGAGAAATGTTGGGCAAAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000032
ALAS2 MISSION shRNA shRNA Plasmid DNA
aminolevulinate, delta-, synthase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1174s1c1
Sequence:CCGGGCGTGATGGAATTATGCATAACTCGAGTTATGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-628s1c1
Sequence:CCGGCGTCTGGTGTAGTAATGATTACTCGAGTAATCATTACTACACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-137s1c1
Sequence:CCGGCACCAGTTCCTGTTTGGTATTCTCGAGAATACCAAACAGGAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1627s1c1
Sequence:CCGGCCCTCAGATGATGGAAGATTTCTCGAGAAATCTTCCATCATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-538s1c1
Sequence:CCGGCCGTGTGTTCAAGACTGTGAACTCGAGTTCACAGTCTTGAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000032.4-1986s21c1
Sequence:CCGGTCTAGCTGAATTGAGCCTAAACTCGAGTTTAGGCTCAATTCAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000032.4-660s21c1
Sequence:CCGGATATCCCTTTGCCCAACATTTCTCGAGAAATGTTGGGCAAAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000032
ALAS2 MISSION shRNA Lentiviral Transduction Particles
aminolevulinate, delta-, synthase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1174s1c1
Sequence:CCGGGCGTGATGGAATTATGCATAACTCGAGTTATGCATAATTCCATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-628s1c1
Sequence:CCGGCGTCTGGTGTAGTAATGATTACTCGAGTAATCATTACTACACCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-137s1c1
Sequence:CCGGCACCAGTTCCTGTTTGGTATTCTCGAGAATACCAAACAGGAACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-1627s1c1
Sequence:CCGGCCCTCAGATGATGGAAGATTTCTCGAGAAATCTTCCATCATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000032.1-538s1c1
Sequence:CCGGCCGTGTGTTCAAGACTGTGAACTCGAGTTCACAGTCTTGAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000032.4-1986s21c1
Sequence:CCGGTCTAGCTGAATTGAGCCTAAACTCGAGTTTAGGCTCAATTCAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000032.4-660s21c1
Sequence:CCGGATATCCCTTTGCCCAACATTTCTCGAGAAATGTTGGGCAAAGGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks