EMAIL THIS PAGE TO A FRIEND

ALB

albumin

151 Gene Product Result for
Synonyms: PRO0883 PRO0903 PRO1341
Gene ID:
Human(213) Summary: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin. [provided by RefSeq, Jul 2008]
Mouse(11657) albumin
Rat(24186) albumin
chicken(396197) albumin
cow(280717) albumin
dog(403550) albumin
Goat(100860821) albumin
sheep(443393) albumin
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108645 Anti-ALB affinity isolated antibody goat, rat, human, rabbit, bovine, sheep, canine, mouse
immunohistochemistry, western blot pricing
SAB2100098 Anti-ALB (ab1) antibody produced in rabbit affinity isolated antibody human, mouse, canine, horse, bovine, rat
western blot pricing
SAB2100099 Anti-ALB (ab2) antibody produced in rabbit affinity isolated antibody horse, human, mouse, rat, guinea pig
western blot pricing
HPA031024 Anti-ALB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA031025 Anti-ALB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
GW10067F Anti-Albumin (serum) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB3500217 Anti-Albumin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
A7544 Anti-Albumin antibody produced in goat whole antiserum human
ELISA, quantitative precipitin assay pricing
A1151 Anti-Albumin antibody produced in goat fractionated antiserum, lyophilized human
immunocytochemistry, immunohistochemistry, Ouchterlony double diffusion pricing
A0433 Anti-Albumin antibody produced in rabbit IgG fraction of antiserum human
ELISA, quantitative precipitin assay pricing
SAB4301142 Anti-BSA antibody produced in rabbit affinity isolated antibody bovine
western blot pricing
A3293 Anti-Human Albumin antibody produced in rabbit whole antiserum human
ELISA, quantitative precipitin assay pricing
SAB4200711 Anti-Human Serum Albumin antibody, Mouse monoclonal clone HSA-11, purified from hybridoma cell culture gibbon, baboon, monkey
ELISA, immunohistochemistry, western blot pricing
WH0000213M1 Monoclonal Anti-ALB antibody produced in mouse clone 1G12-1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
A6684 Monoclonal Anti-Albumin antibody produced in mouse clone HSA-11, ascites fluid human, gibbon, rhesus monkey, baboon
ELISA, immunohistochemistry, western blot pricing
A2672 Monoclonal Anti-Albumin antibody produced in mouse clone HSA-9, ascites fluid baboon, rhesus monkey, human
ELISA pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C70908 5-Chlorosalicylic acid 98% human pricing
B34729 Biphenyl-4-carboxylic acid 95% human pricing
D3281 Diflunisal analytical standard human pricing
F4381 Furosemide human pricing
H4759 Hydrochlorothiazide crystalline human pricing
H2910 Hydrochlorothiazide meets USP testing specifications human pricing
K1751 Ketoprofen ≥98% (TLC) human pricing
K2012 Ketoprofen meets USP testing specifications human pricing
34016 Ketoprofen VETRANAL, analytical standard human pricing
N1016 Nimesulide human pricing
S5922 Salicylic acid BioXtra, ≥99.0% human pricing
S7401 Salicylic acid plant cell culture tested human pricing
247588 Salicylic acid ACS reagent, ≥99.0% human pricing
84210 Salicylic acid puriss. p.a., ≥99.0% (T) human pricing
27301 Salicylic acid meets analytical specification of Ph. Eur., BP, USP, 99.5-100.5% (calc. to the dried substance) human pricing
105910 Salicylic acid ReagentPlus®, ≥99% human pricing
W398500 Salicylic acid ≥99%, FG human pricing
S8139 Sulindac ≥98.0% human pricing
S4429 Sulindac meets USP testing specifications human pricing
C1290 Chlorpropamide analytical standard, ≥97% human, mouse pricing
T0891 Tolbutamide analytical standard human, mouse pricing
46968 Tolbutamide VETRANAL, analytical standard human, mouse pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing
F8514 Flurbiprofen cyclooxygenase inhibitor human, rat pricing

Proteins

Product # Description Species Add to Cart
 
D0565 Digoxin-BSA bovine lyophilized powder cow pricing
SRP6516 Albumin from human plasma ≥95% (SDS-PAGE) human pricing
A9511 Albumin from human serum lyophilized powder, ≥97% (agarose gel electrophoresis) human pricing
A1653 Albumin from human serum lyophilized powder, ≥96% (agarose gel electrophoresis) human pricing
A3782 Albumin from human serum lyophilized powder, Fatty acid free, Globulin free, ≥99% (agarose gel electrophoresis) human pricing
A8763 Albumin from human serum lyophilized powder, essentially globulin free, ≥99% (agarose gel electrophoresis) human pricing
A1887 Albumin from human serum lyophilized powder, essentially fatty acid free human pricing
A5843 Albumin from human serum lyophilized powder, low endotoxin human pricing
A4327 Albumin from human serum lyophilized powder, essentially protease free, ≥96% (agarose gel electrophoresis) human pricing
05420 Albumin from human serum lyophilized powder, ≥95.0% (agarose gel electrophoresis) human pricing
A9731 Albumin human recombinant, expressed in rice, lyophilized powder, cell culture tested, low endotoxin, ≥96% (Excised bands analyzed by MS to yield total albumin content, PAGE) human pricing
A6608 Albumin human recombinant, expressed in Saccharomyces cerevisiae, aqueous solution, 10% in aqueous buffer, ≥99% (agarose gel electrophoresis) human pricing
A7223 Albumin human recombinant, expressed in Pichia pastoris, 5% in aqueous buffer, ≥90% (SDS-PAGE) human pricing
A9986 Albumin human recombinant, expressed in rice, lyophilized powder, Immunoglobin-free, ≥96% (SDS-PAGE) human pricing
A0237 Albumin human recombinant, expressed in rice, lyophilized powder, cell culture tested, low endotoxin and lipid-reduced, ≥90% (SDS-PAGE) human pricing
A9080 Albumin solution human aseptically filled, 30% in 0.85% sodium chloride, protease free human pricing
A6784 Albumin solution human 10% in 0.85% sodium chloride and 0.05% sodium azide, aseptically filled human pricing
A6661 Albumin, dinitrophenyl lyophilized powder human pricing
A8301 Albumin, glycated human lyophilized powder human pricing
APREST87036 PrEST Antigen ALB Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST87037 PrEST Antigen ALB Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22560 SILuPrEST ALBU SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22561 SILuPrEST ALBU SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
A2889 Albumin–fluorescein isothiocyanate conjugate albumin from rat rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000477 Rosetta Predictions human pricing
NM_134326 Rosetta Predictions rat pricing
NM_009654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103661 predicted 1016
2 SASI_Hs01_00103666 predicted 812
3 SASI_Hs01_00103667 predicted 735
4 SASI_Hs01_00103669 predicted 1313
5 SASI_Hs02_00302616 predicted 1806
6 SASI_Hs01_00103670 predicted 474
7 SASI_Hs02_00302617 predicted 656
8 SASI_Hs02_00302618 predicted 699
9 SASI_Hs02_00302619 predicted 1602
10 SASI_Hs01_00103662 predicted 215
11 SASI_Hs01_00103663 predicted 1203
12 SASI_Hs01_00103664 predicted 404
13 SASI_Hs01_00103665 predicted 1630
14 SASI_Hs01_00103668 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267863 predicted 864
2 SASI_Rn02_00267864 predicted 1122
3 SASI_Rn01_00043932 predicted 294
4 SASI_Rn01_00043929 predicted 518
5 SASI_Rn02_00267865 predicted 958
6 SASI_Rn02_00267866 predicted 288
7 SASI_Rn02_00267867 predicted 625
8 SASI_Rn01_00043933 predicted 210
9 SASI_Rn01_00043935 predicted 900
10 SASI_Rn01_00043936 predicted 1248
11 SASI_Rn01_00043927 predicted 949
12 SASI_Rn01_00043928 predicted 1213
13 SASI_Rn01_00043930 predicted 749
14 SASI_Rn01_00043931 predicted 721
15 SASI_Rn01_00043934 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054486 predicted 950
2 SASI_Mm01_00054487 predicted 219
3 SASI_Mm01_00054488 predicted 664
4 SASI_Mm01_00054489 predicted 411
5 SASI_Mm01_00054490 predicted 270
6 SASI_Mm01_00054491 predicted 302
7 SASI_Mm02_00316655 predicted 962
8 SASI_Mm02_00316656 predicted 1245
9 SASI_Mm01_00054493 predicted 802
10 SASI_Mm01_00054494 predicted 518
11 SASI_Mm01_00054492 predicted 1151
12 SASI_Mm01_00054495 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000477
ALB MISSION shRNA Bacterial Glycerol Stock
albumin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-373s21c1
Sequence:CCGGAGTTGCAACTCTTCGTGAAACCTCGAGGTTTCACGAAGAGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-1883s21c1
Sequence:CCGGCAAGCTGCCTTAGGCTTATAACTCGAGTTATAAGCCTAAGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1621s1c1
Sequence:CCGGGCTGAAACATTCACCTTCCATCTCGAGATGGAAGGTGAATGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-538s1c1
Sequence:CCGGGCCAGAAGACATCCTTACTTTCTCGAGAAAGTAAGGATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1017s1c1
Sequence:CCGGGCCTTCATTAGCTGCTGATTTCTCGAGAAATCAGCAGCTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1450s1c1
Sequence:CCGGCCCTGTGCAGAAGACTATCTACTCGAGTAGATAGTCTTCTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000477
ALB MISSION shRNA shRNA Plasmid DNA
albumin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-373s21c1
Sequence:CCGGAGTTGCAACTCTTCGTGAAACCTCGAGGTTTCACGAAGAGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-1883s21c1
Sequence:CCGGCAAGCTGCCTTAGGCTTATAACTCGAGTTATAAGCCTAAGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1621s1c1
Sequence:CCGGGCTGAAACATTCACCTTCCATCTCGAGATGGAAGGTGAATGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-538s1c1
Sequence:CCGGGCCAGAAGACATCCTTACTTTCTCGAGAAAGTAAGGATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1017s1c1
Sequence:CCGGGCCTTCATTAGCTGCTGATTTCTCGAGAAATCAGCAGCTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1450s1c1
Sequence:CCGGCCCTGTGCAGAAGACTATCTACTCGAGTAGATAGTCTTCTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000477
ALB MISSION shRNA Lentiviral Transduction Particles
albumin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-373s21c1
Sequence:CCGGAGTTGCAACTCTTCGTGAAACCTCGAGGTTTCACGAAGAGTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000477.5-1883s21c1
Sequence:CCGGCAAGCTGCCTTAGGCTTATAACTCGAGTTATAAGCCTAAGGCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1621s1c1
Sequence:CCGGGCTGAAACATTCACCTTCCATCTCGAGATGGAAGGTGAATGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-538s1c1
Sequence:CCGGGCCAGAAGACATCCTTACTTTCTCGAGAAAGTAAGGATGTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1017s1c1
Sequence:CCGGGCCTTCATTAGCTGCTGATTTCTCGAGAAATCAGCAGCTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000477.3-1450s1c1
Sequence:CCGGCCCTGTGCAGAAGACTATCTACTCGAGTAGATAGTCTTCTGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009654
ALB MISSION shRNA Bacterial Glycerol Stock
albumin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-513s21c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009654.3-1874s21c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-403s21c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-1150s21c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009654.1-1863s1c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-392s1c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-1139s1c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-941s1c1
Sequence:CCGGCTGCGATAAACCACTGTTGAACTCGAGTTCAACAGTGGTTTATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-502s1c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009654
ALB MISSION shRNA shRNA Plasmid DNA
albumin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-513s21c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009654.3-1874s21c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-403s21c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-1150s21c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009654.1-1863s1c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-392s1c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-1139s1c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-941s1c1
Sequence:CCGGCTGCGATAAACCACTGTTGAACTCGAGTTCAACAGTGGTTTATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-502s1c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009654
ALB MISSION shRNA Lentiviral Transduction Particles
albumin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-513s21c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009654.3-1874s21c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-403s21c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009654.3-1150s21c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009654.1-1863s1c1
Sequence:CCGGACACATCACAACCACAACCTTCTCGAGAAGGTTGTGGTTGTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-392s1c1
Sequence:CCGGGCCCGAAAGAAACGAATGTTTCTCGAGAAACATTCGTTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-1139s1c1
Sequence:CCGGCCTGTTGCTGAGACTTGCTAACTCGAGTTAGCAAGTCTCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-941s1c1
Sequence:CCGGCTGCGATAAACCACTGTTGAACTCGAGTTCAACAGTGGTTTATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009654.1-502s1c1
Sequence:CCGGCCACCTTTATGGGACACTATTCTCGAGAATAGTGTCCCATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks