EMAIL THIS PAGE TO A FRIEND

ALCAM

activated leukocyte cell adhesion molecule

112 Gene Product Result for
Synonyms: CD166 MEMD
UniProtKB ID: Q13740, B2RNS3, B4DTU0, O60892, Q1HGM8, Q1HGM9
Gene ID:
Human(214) Summary: This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
Mouse(11658) activated leukocyte cell adhesion molecule
Rat(79559) activated leukocyte cell adhesion molecule
domestic guinea pig(100726386) activated leukocyte cell adhesion molecule
naked mole-rat(101720697) activated leukocyte cell adhesion molecule
sheep(101114151) activated leukocyte cell adhesion molecule
Domestic Rabbit(100009305) activated leukocyte cell adhesion molecule
chicken(396092) activated leukocyte cell adhesion molecule
domestic cat(101101074) activated leukocyte cell adhesion molecule
cow(281614) activated leukocyte cell adhesion molecule
Horse(100061848) activated leukocyte cell adhesion molecule
dog(478550) activated leukocyte cell adhesion molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001627 Rosetta Predictions human pricing
NM_031753 Rosetta Predictions rat pricing
NM_009655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210533 predicted 2298
2 SASI_Hs01_00210534 predicted 864
3 SASI_Hs01_00210535 predicted 958
4 SASI_Hs01_00210536 predicted 1460
5 SASI_Hs01_00210537 predicted 636
6 SASI_Hs01_00210539 predicted 909
7 SASI_Hs01_00210540 predicted 1435
8 SASI_Hs01_00210541 predicted 1647
9 SASI_Hs01_00210542 predicted 1160
10 SASI_Hs02_00332199 predicted 2034
11 SASI_Hs01_00210538 predicted 1971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048565 predicted 1931
2 SASI_Rn01_00048566 predicted 1990
3 SASI_Rn01_00048567 predicted 508
4 SASI_Rn01_00048568 predicted 1747
5 SASI_Rn01_00048569 predicted 1550
6 SASI_Rn01_00048570 predicted 494
7 SASI_Rn01_00048571 predicted 477
8 SASI_Rn01_00048572 predicted 765
9 SASI_Rn01_00048573 predicted 1981
10 SASI_Rn02_00265167 predicted 1106
11 SASI_Rn01_00048574 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316657 predicted 2064
2 SASI_Mm01_00120976 predicted 726
3 SASI_Mm01_00120977 predicted 1238
4 SASI_Mm02_00316658 predicted 888
5 SASI_Mm01_00120980 predicted 1455
6 SASI_Mm01_00120981 predicted 1416
7 SASI_Mm01_00120982 predicted 854
8 SASI_Mm01_00120983 predicted 930
9 SASI_Mm01_00120984 predicted 1163
10 SASI_Mm01_00120985 predicted 1960
11 SASI_Mm01_00120978 predicted 3051
12 SASI_Mm01_00120979 predicted 2977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001627
VALIDATED
ALCAM MISSION shRNA Bacterial Glycerol Stock
activated leukocyte cell adhesion molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001627.1-2029s1c1
Sequence:CCGGGCAGCCATGATAATAGGTCATCTCGAGATGACCTATTATCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-929s1c1
Sequence:CCGGCCGAAGGAATAAGAAGCTCAACTCGAGTTGAGCTTCTTATTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-193s1c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001627.1-2030s1c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001627.1-930s1c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001627.1-1139s1c1
Sequence:CCGGGCAGGAATGCAACTGTGGTATCTCGAGATACCACAGTTGCATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1657s21c1
Sequence:CCGGCTTCGATCTAGCCCGTCATTTCTCGAGAAATGACGGGCTAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1407s21c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-670s21c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001627.2-2507s21c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001627
VALIDATED
ALCAM MISSION shRNA shRNA Plasmid DNA
activated leukocyte cell adhesion molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001627.1-2029s1c1
Sequence:CCGGGCAGCCATGATAATAGGTCATCTCGAGATGACCTATTATCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-929s1c1
Sequence:CCGGCCGAAGGAATAAGAAGCTCAACTCGAGTTGAGCTTCTTATTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-193s1c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001627.1-2030s1c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001627.1-930s1c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001627.1-1139s1c1
Sequence:CCGGGCAGGAATGCAACTGTGGTATCTCGAGATACCACAGTTGCATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1657s21c1
Sequence:CCGGCTTCGATCTAGCCCGTCATTTCTCGAGAAATGACGGGCTAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1407s21c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-670s21c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001627.2-2507s21c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001627
VALIDATED
ALCAM MISSION shRNA Lentiviral Transduction Particles
activated leukocyte cell adhesion molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001627.1-2029s1c1
Sequence:CCGGGCAGCCATGATAATAGGTCATCTCGAGATGACCTATTATCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-929s1c1
Sequence:CCGGCCGAAGGAATAAGAAGCTCAACTCGAGTTGAGCTTCTTATTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001627.1-193s1c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001627.1-2030s1c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001627.1-930s1c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001627.1-1139s1c1
Sequence:CCGGGCAGGAATGCAACTGTGGTATCTCGAGATACCACAGTTGCATTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1657s21c1
Sequence:CCGGCTTCGATCTAGCCCGTCATTTCTCGAGAAATGACGGGCTAGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-1407s21c1
Sequence:CCGGCGAAGGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001627.2-670s21c1
Sequence:CCGGCGACTTGACGTACCTCAGAATCTCGAGATTCTGAGGTACGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001627.2-2507s21c1
Sequence:CCGGCAGCCATGATAATAGGTCATACTCGAGTATGACCTATTATCATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009655
ALCAM MISSION shRNA Bacterial Glycerol Stock
activated leukocyte cell adhesion molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009655.1-3419s1c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-3037s1c1
Sequence:CCGGCCTGAGGAGAATGTAACATTACTCGAGTAATGTTACATTCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2767s1c1
Sequence:CCGGGCTGGGAACTATGTCTGTGAACTCGAGTTCACAGACATAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2935s1c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2312s1c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-2055s21c1
Sequence:CCGGACGATGAGGCAGACGATATAACTCGAGTTATATCGTCTGCCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1186s21c1
Sequence:CCGGCACCTGTTCTGTGACATATTACTCGAGTAATATGTCACAGAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009655.2-2343s21c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1236s21c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1859s21c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009655
ALCAM MISSION shRNA shRNA Plasmid DNA
activated leukocyte cell adhesion molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009655.1-3419s1c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-3037s1c1
Sequence:CCGGCCTGAGGAGAATGTAACATTACTCGAGTAATGTTACATTCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2767s1c1
Sequence:CCGGGCTGGGAACTATGTCTGTGAACTCGAGTTCACAGACATAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2935s1c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2312s1c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-2055s21c1
Sequence:CCGGACGATGAGGCAGACGATATAACTCGAGTTATATCGTCTGCCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1186s21c1
Sequence:CCGGCACCTGTTCTGTGACATATTACTCGAGTAATATGTCACAGAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009655.2-2343s21c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1236s21c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1859s21c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009655
ALCAM MISSION shRNA Lentiviral Transduction Particles
activated leukocyte cell adhesion molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009655.1-3419s1c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-3037s1c1
Sequence:CCGGCCTGAGGAGAATGTAACATTACTCGAGTAATGTTACATTCTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2767s1c1
Sequence:CCGGGCTGGGAACTATGTCTGTGAACTCGAGTTCACAGACATAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2935s1c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009655.1-2312s1c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-2055s21c1
Sequence:CCGGACGATGAGGCAGACGATATAACTCGAGTTATATCGTCTGCCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1186s21c1
Sequence:CCGGCACCTGTTCTGTGACATATTACTCGAGTAATATGTCACAGAACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009655.2-2343s21c1
Sequence:CCGGCGTGGATTGTATTTAAGACATCTCGAGATGTCTTAAATACAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1236s21c1
Sequence:CCGGCCGAACAAGAAATCTTTGATACTCGAGTATCAAAGATTTCTTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009655.2-1859s21c1
Sequence:CCGGCCAGCTATACATTGGACCATTCTCGAGAATGGTCCAATGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks