EMAIL THIS PAGE TO A FRIEND

ALDH16A1

aldehyde dehydrogenase 16 family, member A1

56 Gene Product Result for
UniProtKB ID: Q8IZ83, B4DLQ1, C9JBH6, Q86YF0, Q8IYL4, Q8TEI8
Gene ID:
Human(126133) Summary: This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(69748) aldehyde dehydrogenase 16 family, member A1
Rat(361571) aldehyde dehydrogenase 16 family, member A1
Zebrafish(492710) aldehyde dehydrogenase 16 family, member A1
cow(506329) aldehyde dehydrogenase 16 family, member A1
domestic cat(101082028) aldehyde dehydrogenase 16 family, member A1
dog(610267) aldehyde dehydrogenase 16 family, member A1
naked mole-rat(101700529) aldehyde dehydrogenase 16 family, member A1
domestic guinea pig(100727478) aldehyde dehydrogenase 16 family, member A1
sheep(101111900) aldehyde dehydrogenase 16 family, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153329 Rosetta Predictions human pricing
NM_001033706 Rosetta Predictions rat pricing
NM_145954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162896 predicted 223
2 SASI_Hs01_00162897 predicted 613
3 SASI_Hs01_00162898 predicted 217
4 SASI_Hs01_00162899 predicted 2345
5 SASI_Hs01_00162901 predicted 1320
6 SASI_Hs01_00162902 predicted 459
7 SASI_Hs01_00162903 predicted 578
8 SASI_Hs01_00162904 predicted 735
9 SASI_Hs01_00162905 predicted 1167
10 SASI_Hs02_00367178 predicted 278
11 SASI_Hs01_00162900 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079301 predicted 1987
2 SASI_Rn01_00079302 predicted 1260
3 SASI_Rn01_00079303 predicted 2178
4 SASI_Rn01_00079304 predicted 597
5 SASI_Rn01_00079305 predicted 2121
6 SASI_Rn01_00079306 predicted 1694
7 SASI_Rn01_00079307 predicted 1391
8 SASI_Rn01_00079308 predicted 1552
9 SASI_Rn01_00079309 predicted 1525
10 SASI_Rn01_00079310 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083606 predicted 1260
2 SASI_Mm01_00083607 predicted 1349
3 SASI_Mm01_00083608 predicted 1978
4 SASI_Mm01_00083610 predicted 1643
5 SASI_Mm01_00083611 predicted 1905
6 SASI_Mm01_00083612 predicted 2327
7 SASI_Mm01_00083613 predicted 1547
8 SASI_Mm01_00083614 predicted 1548
9 SASI_Mm02_00341420 predicted 2252
10 SASI_Mm01_00083615 predicted 2177
11 SASI_Mm01_00083609 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153329
VALIDATED
ALDH16A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 16 family, member A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-2174s21c1
Sequence:CCGGCTACGGCAACACTGTGGTCATCTCGAGATGACCACAGTGTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-246s21c1
Sequence:CCGGGTGAATGGGAAGTGGTTAAAGCTCGAGCTTTAACCACTTCCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2647s21c1
Sequence:CCGGAGCTGTGCTTCTGCGAGAAGACTCGAGTCTTCTCGCAGAAGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2610s21c1
Sequence:CCGGGTTCCTGTGTCTCCCAATAAACTCGAGTTTATTGGGAGACACAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-613s1c1
Sequence:CCGGCCTTGAGATGATGTGGAGGATCTCGAGATCCTCCACATCATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153329.2-571s1c1
Sequence:CCGGCATGGGAGTAATTGGCCTCATCTCGAGATGAGGCCAATTACTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-2297s1c1
Sequence:CCGGGCCATGTGGTATTTCGGATCACTCGAGTGATCCGAAATACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-508s1c1
Sequence:CCGGGCTGCTCCACTACCATGCAATCTCGAGATTGCATGGTAGTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-1565s1c1
Sequence:CCGGCTCTCCAAGAACCTGAACTATCTCGAGATAGTTCAGGTTCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153329
VALIDATED
ALDH16A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 16 family, member A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-2174s21c1
Sequence:CCGGCTACGGCAACACTGTGGTCATCTCGAGATGACCACAGTGTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-246s21c1
Sequence:CCGGGTGAATGGGAAGTGGTTAAAGCTCGAGCTTTAACCACTTCCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2647s21c1
Sequence:CCGGAGCTGTGCTTCTGCGAGAAGACTCGAGTCTTCTCGCAGAAGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2610s21c1
Sequence:CCGGGTTCCTGTGTCTCCCAATAAACTCGAGTTTATTGGGAGACACAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-613s1c1
Sequence:CCGGCCTTGAGATGATGTGGAGGATCTCGAGATCCTCCACATCATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153329.2-571s1c1
Sequence:CCGGCATGGGAGTAATTGGCCTCATCTCGAGATGAGGCCAATTACTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-2297s1c1
Sequence:CCGGGCCATGTGGTATTTCGGATCACTCGAGTGATCCGAAATACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-508s1c1
Sequence:CCGGGCTGCTCCACTACCATGCAATCTCGAGATTGCATGGTAGTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-1565s1c1
Sequence:CCGGCTCTCCAAGAACCTGAACTATCTCGAGATAGTTCAGGTTCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153329
VALIDATED
ALDH16A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 16 family, member A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-2174s21c1
Sequence:CCGGCTACGGCAACACTGTGGTCATCTCGAGATGACCACAGTGTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153329.3-246s21c1
Sequence:CCGGGTGAATGGGAAGTGGTTAAAGCTCGAGCTTTAACCACTTCCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2647s21c1
Sequence:CCGGAGCTGTGCTTCTGCGAGAAGACTCGAGTCTTCTCGCAGAAGCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153329.3-2610s21c1
Sequence:CCGGGTTCCTGTGTCTCCCAATAAACTCGAGTTTATTGGGAGACACAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-613s1c1
Sequence:CCGGCCTTGAGATGATGTGGAGGATCTCGAGATCCTCCACATCATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153329.2-571s1c1
Sequence:CCGGCATGGGAGTAATTGGCCTCATCTCGAGATGAGGCCAATTACTCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-2297s1c1
Sequence:CCGGGCCATGTGGTATTTCGGATCACTCGAGTGATCCGAAATACCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-508s1c1
Sequence:CCGGGCTGCTCCACTACCATGCAATCTCGAGATTGCATGGTAGTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_153329.2-1565s1c1
Sequence:CCGGCTCTCCAAGAACCTGAACTATCTCGAGATAGTTCAGGTTCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145954
ALDH16A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 16 family, member A1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-173s21c1
Sequence:CCGGTCTTGGGCCACCATGTCAATGCTCGAGCATTGACATGGTGGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1538s21c1
Sequence:CCGGAGTCCTTCCTTTGTGAGAATACTCGAGTATTCTCACAAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1028s21c1
Sequence:CCGGAGGCCAGAATGGCACAGATACCTCGAGGTATCTGTGCCATTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1397s21c1
Sequence:CCGGTGGGCACAGTGTGGATCAATGCTCGAGCATTGATCCACACTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-880s21c1
Sequence:CCGGACAGAGTCACTGTTGCTATTGCTCGAGCAATAGCAACAGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1554s1c1
Sequence:CCGGGAATATCAACTACGACACATTCTCGAGAATGTGTCGTAGTTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-878s1c1
Sequence:CCGGGCACAGAGTCACTGTTGCTATCTCGAGATAGCAACAGTGACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1545s1c1
Sequence:CCGGCCTTTGTGAGAATATCAACTACTCGAGTAGTTGATATTCTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145954
ALDH16A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 16 family, member A1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-173s21c1
Sequence:CCGGTCTTGGGCCACCATGTCAATGCTCGAGCATTGACATGGTGGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1538s21c1
Sequence:CCGGAGTCCTTCCTTTGTGAGAATACTCGAGTATTCTCACAAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1028s21c1
Sequence:CCGGAGGCCAGAATGGCACAGATACCTCGAGGTATCTGTGCCATTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1397s21c1
Sequence:CCGGTGGGCACAGTGTGGATCAATGCTCGAGCATTGATCCACACTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-880s21c1
Sequence:CCGGACAGAGTCACTGTTGCTATTGCTCGAGCAATAGCAACAGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1554s1c1
Sequence:CCGGGAATATCAACTACGACACATTCTCGAGAATGTGTCGTAGTTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-878s1c1
Sequence:CCGGGCACAGAGTCACTGTTGCTATCTCGAGATAGCAACAGTGACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1545s1c1
Sequence:CCGGCCTTTGTGAGAATATCAACTACTCGAGTAGTTGATATTCTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145954
ALDH16A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 16 family, member A1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-173s21c1
Sequence:CCGGTCTTGGGCCACCATGTCAATGCTCGAGCATTGACATGGTGGCCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1538s21c1
Sequence:CCGGAGTCCTTCCTTTGTGAGAATACTCGAGTATTCTCACAAAGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1028s21c1
Sequence:CCGGAGGCCAGAATGGCACAGATACCTCGAGGTATCTGTGCCATTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-1397s21c1
Sequence:CCGGTGGGCACAGTGTGGATCAATGCTCGAGCATTGATCCACACTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145954.1-880s21c1
Sequence:CCGGACAGAGTCACTGTTGCTATTGCTCGAGCAATAGCAACAGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1554s1c1
Sequence:CCGGGAATATCAACTACGACACATTCTCGAGAATGTGTCGTAGTTGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-878s1c1
Sequence:CCGGGCACAGAGTCACTGTTGCTATCTCGAGATAGCAACAGTGACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145954.1-1545s1c1
Sequence:CCGGCCTTTGTGAGAATATCAACTACTCGAGTAGTTGATATTCTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks