EMAIL THIS PAGE TO A FRIEND

ALDH18A1

aldehyde dehydrogenase 18 family, member A1

117 Gene Product Result for
Synonyms: ARCL3A GSAS P5CS PYCS
Gene ID:
Human(5832) Summary: This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(56454) aldehyde dehydrogenase 18 family, member A1
Rat(361755) aldehyde dehydrogenase 18 family, member A1
sheep(101108974) aldehyde dehydrogenase 18 family, member A1
Domestic Rabbit(100352530) aldehyde dehydrogenase 18 family, member A1
domestic guinea pig(100716882) aldehyde dehydrogenase 18 family, member A1
naked mole-rat(101713177) aldehyde dehydrogenase 18 family, member A1
Zebrafish(557186) aldehyde dehydrogenase 18 family, member A1
dog(477781) aldehyde dehydrogenase 18 family, member A1
domestic cat(101090803) aldehyde dehydrogenase 18 family, member A1
cow(514759) aldehyde dehydrogenase 18 family, member A1
Horse(100061213) aldehyde dehydrogenase 18 family, member A1
chicken(423976) aldehyde dehydrogenase 18 family, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037001 MISSION® esiRNA esiRNA human ALDH18A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017423 Rosetta Predictions human pricing
NM_002860 Rosetta Predictions human pricing
NM_001108524 Rosetta Predictions rat pricing
NM_019698 Rosetta Predictions mouse pricing
NM_153554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134100 predicted 2209
2 SASI_Hs01_00134101 predicted 287
3 SASI_Hs01_00134103 predicted 1801
4 SASI_Hs01_00134104 predicted 310
5 SASI_Hs01_00134105 predicted 2039
6 SASI_Hs01_00134106 predicted 349
7 SASI_Hs01_00134107 predicted 520
8 SASI_Hs01_00134108 predicted 2129
9 SASI_Hs01_00134109 predicted 1818
10 SASI_Hs02_00306749 predicted 1428
11 SASI_Hs01_00134102 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334625 predicted 1864
2 SASI_Hs01_00151209 predicted 286
3 SASI_Hs01_00151211 predicted 1803
4 SASI_Hs01_00151212 predicted 308
5 SASI_Hs01_00151214 predicted 351
6 SASI_Hs01_00151215 predicted 527
7 SASI_Hs01_00151217 predicted 1818
8 SASI_Hs02_00334626 predicted 1433
9 SASI_Hs02_00334627 predicted 695
10 SASI_Hs02_00334628 predicted 601
11 SASI_Hs01_00151208 predicted 2219
12 SASI_Hs01_00151210 predicted 1326
13 SASI_Hs01_00151213 predicted 2048
14 SASI_Hs01_00151216 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239499 predicted 2042
2 SASI_Rn02_00239500 predicted 869
3 SASI_Rn02_00239501 predicted 444
4 SASI_Rn02_00239502 predicted 2352
5 SASI_Rn02_00239503 predicted 1193
6 SASI_Rn02_00239504 predicted 2488
7 SASI_Rn02_00239505 predicted 1352
8 SASI_Rn02_00239506 predicted 1915
9 SASI_Rn02_00239507 predicted 673
10 SASI_Rn02_00239508 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167591 predicted 1780
2 SASI_Mm01_00167592 predicted 1274
3 SASI_Mm01_00167593 predicted 1871
4 SASI_Mm01_00167594 predicted 438
5 SASI_Mm01_00167595 predicted 263
6 SASI_Mm01_00167596 predicted 1189
7 SASI_Mm01_00167597 predicted 1352
8 SASI_Mm01_00167598 predicted 1301
9 SASI_Mm01_00167599 predicted 1761
10 SASI_Mm02_00324799 predicted 1979
11 SASI_Mm01_00167590 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147263 predicted 1770
2 SASI_Mm01_00147264 predicted 1262
3 SASI_Mm01_00147265 predicted 1861
4 SASI_Mm01_00147266 predicted 430
5 SASI_Mm01_00147267 predicted 260
6 SASI_Mm01_00147268 predicted 1179
7 SASI_Mm01_00147269 predicted 1341
8 SASI_Mm01_00147270 predicted 1295
9 SASI_Mm01_00147271 predicted 1762
10 SASI_Mm02_00343335 predicted 1974
11 SASI_Mm01_00147262 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002860
VALIDATED
ALDH18A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 18 family, member A1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-343s1c1
Sequence:CCGGGCATCTATTGTTGAGCAGGTACTCGAGTACCTGCTCAACAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-1939s1c1
Sequence:CCGGCCATTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-213s1c1
Sequence:CCGGCCTCAGTCGTACACATGGAAACTCGAGTTTCCATGTGTACGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-658s1c1
Sequence:CCGGCGGAACCTCAATGGAACACTTCTCGAGAAGTGTTCCATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-568s1c1
Sequence:CCGGGCCTTGTATGAGGCTATGTTTCTCGAGAAACATAGCCTCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-1834s21c1
Sequence:CCGGAGGCCGTGCAACTGGTGAATACTCGAGTATTCACCAGTTGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2460s21c1
Sequence:CCGGGGAATCAGTACATCGAGAATCCTCGAGGATTCTCGATGTACTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2863s21c1
Sequence:CCGGACTTTGCCAAGTCCAATTATCCTCGAGGATAATTGGACTTGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2668s21c1
Sequence:CCGGTTCACGTTAAACTTGTCTTATCTCGAGATAAGACAAGTTTAACGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2038s21c1
Sequence:CCGGGGCTAGTCAGAGACTCTAAATCTCGAGATTTAGAGTCTCTGACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2009s21c1
Sequence:CCGGTTCCGAGGCCAGTGTTGATAACTCGAGTTATCAACACTGGCCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-368s21c1
Sequence:CCGGTTGGAGCAACATCCCGTTTATCTCGAGATAAACGGGATGTTGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2989s21c1
Sequence:CCGGACTAGAGCCAGTCATCCTTAACTCGAGTTAAGGATGACTGGCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002860
VALIDATED
ALDH18A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 18 family, member A1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-343s1c1
Sequence:CCGGGCATCTATTGTTGAGCAGGTACTCGAGTACCTGCTCAACAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-1939s1c1
Sequence:CCGGCCATTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-213s1c1
Sequence:CCGGCCTCAGTCGTACACATGGAAACTCGAGTTTCCATGTGTACGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-658s1c1
Sequence:CCGGCGGAACCTCAATGGAACACTTCTCGAGAAGTGTTCCATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-568s1c1
Sequence:CCGGGCCTTGTATGAGGCTATGTTTCTCGAGAAACATAGCCTCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-1834s21c1
Sequence:CCGGAGGCCGTGCAACTGGTGAATACTCGAGTATTCACCAGTTGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2460s21c1
Sequence:CCGGGGAATCAGTACATCGAGAATCCTCGAGGATTCTCGATGTACTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2863s21c1
Sequence:CCGGACTTTGCCAAGTCCAATTATCCTCGAGGATAATTGGACTTGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2668s21c1
Sequence:CCGGTTCACGTTAAACTTGTCTTATCTCGAGATAAGACAAGTTTAACGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2038s21c1
Sequence:CCGGGGCTAGTCAGAGACTCTAAATCTCGAGATTTAGAGTCTCTGACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2009s21c1
Sequence:CCGGTTCCGAGGCCAGTGTTGATAACTCGAGTTATCAACACTGGCCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-368s21c1
Sequence:CCGGTTGGAGCAACATCCCGTTTATCTCGAGATAAACGGGATGTTGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2989s21c1
Sequence:CCGGACTAGAGCCAGTCATCCTTAACTCGAGTTAAGGATGACTGGCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002860
VALIDATED
ALDH18A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 18 family, member A1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-343s1c1
Sequence:CCGGGCATCTATTGTTGAGCAGGTACTCGAGTACCTGCTCAACAATAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-1939s1c1
Sequence:CCGGCCATTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-213s1c1
Sequence:CCGGCCTCAGTCGTACACATGGAAACTCGAGTTTCCATGTGTACGACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-658s1c1
Sequence:CCGGCGGAACCTCAATGGAACACTTCTCGAGAAGTGTTCCATTGAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002860.2-568s1c1
Sequence:CCGGGCCTTGTATGAGGCTATGTTTCTCGAGAAACATAGCCTCATACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-1834s21c1
Sequence:CCGGAGGCCGTGCAACTGGTGAATACTCGAGTATTCACCAGTTGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2460s21c1
Sequence:CCGGGGAATCAGTACATCGAGAATCCTCGAGGATTCTCGATGTACTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2863s21c1
Sequence:CCGGACTTTGCCAAGTCCAATTATCCTCGAGGATAATTGGACTTGGCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2668s21c1
Sequence:CCGGTTCACGTTAAACTTGTCTTATCTCGAGATAAGACAAGTTTAACGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2038s21c1
Sequence:CCGGGGCTAGTCAGAGACTCTAAATCTCGAGATTTAGAGTCTCTGACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-2009s21c1
Sequence:CCGGTTCCGAGGCCAGTGTTGATAACTCGAGTTATCAACACTGGCCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002860.3-368s21c1
Sequence:CCGGTTGGAGCAACATCCCGTTTATCTCGAGATAAACGGGATGTTGCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002860.3-2989s21c1
Sequence:CCGGACTAGAGCCAGTCATCCTTAACTCGAGTTAAGGATGACTGGCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153554
VALIDATED
ALDH18A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 18 family, member A1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-360s1c1
Sequence:CCGGCGCCAAGAGAATTGTAGTGAACTCGAGTTCACTACAATTCTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2485s1c1
Sequence:CCGGCTCAAGTATCTTCACGAGAATCTCGAGATTCTCGTGAAGATACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2695s1c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-802s1c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153554.1-2029s1c1
Sequence:CCGGCCCTTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-246s21c1
Sequence:CCGGTGTCCAGCCCTCAGCTATTAGCTCGAGCTAATAGCTGAGGGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2017s21c1
Sequence:CCGGCTGCTGAGAACACCCTTATTTCTCGAGAAATAAGGGTGTTCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-223s21c1
Sequence:CCGGATAGCTGTGCCCAGATCAAATCTCGAGATTTGATCTGGGCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2695s21c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-319s21c1
Sequence:CCGGTAGCTGTGCCCAGATCAAATCCTCGAGGATTTGATCTGGGCACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2111s21c1
Sequence:CCGGTCTGCTGAGAACACCCTTATTCTCGAGAATAAGGGTGTTCTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2292s21c1
Sequence:CCGGGCCATTGATCACATCCATAAGCTCGAGCTTATGGATGTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-802s21c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153554
VALIDATED
ALDH18A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 18 family, member A1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-360s1c1
Sequence:CCGGCGCCAAGAGAATTGTAGTGAACTCGAGTTCACTACAATTCTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2485s1c1
Sequence:CCGGCTCAAGTATCTTCACGAGAATCTCGAGATTCTCGTGAAGATACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2695s1c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-802s1c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153554.1-2029s1c1
Sequence:CCGGCCCTTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-246s21c1
Sequence:CCGGTGTCCAGCCCTCAGCTATTAGCTCGAGCTAATAGCTGAGGGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2017s21c1
Sequence:CCGGCTGCTGAGAACACCCTTATTTCTCGAGAAATAAGGGTGTTCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-223s21c1
Sequence:CCGGATAGCTGTGCCCAGATCAAATCTCGAGATTTGATCTGGGCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2695s21c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-319s21c1
Sequence:CCGGTAGCTGTGCCCAGATCAAATCCTCGAGGATTTGATCTGGGCACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2111s21c1
Sequence:CCGGTCTGCTGAGAACACCCTTATTCTCGAGAATAAGGGTGTTCTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2292s21c1
Sequence:CCGGGCCATTGATCACATCCATAAGCTCGAGCTTATGGATGTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-802s21c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153554
VALIDATED
ALDH18A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 18 family, member A1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-360s1c1
Sequence:CCGGCGCCAAGAGAATTGTAGTGAACTCGAGTTCACTACAATTCTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2485s1c1
Sequence:CCGGCTCAAGTATCTTCACGAGAATCTCGAGATTCTCGTGAAGATACTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-2695s1c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153554.1-802s1c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153554.1-2029s1c1
Sequence:CCGGCCCTTATTTGACCAGATCATTCTCGAGAATGATCTGGTCAAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-246s21c1
Sequence:CCGGTGTCCAGCCCTCAGCTATTAGCTCGAGCTAATAGCTGAGGGCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2017s21c1
Sequence:CCGGCTGCTGAGAACACCCTTATTTCTCGAGAAATAAGGGTGTTCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-223s21c1
Sequence:CCGGATAGCTGTGCCCAGATCAAATCTCGAGATTTGATCTGGGCACAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-2695s21c1
Sequence:CCGGGCTAATGTTCACACTCCATTTCTCGAGAAATGGAGTGTGAACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-319s21c1
Sequence:CCGGTAGCTGTGCCCAGATCAAATCCTCGAGGATTTGATCTGGGCACAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2111s21c1
Sequence:CCGGTCTGCTGAGAACACCCTTATTCTCGAGAATAAGGGTGTTCTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.2-2292s21c1
Sequence:CCGGGCCATTGATCACATCCATAAGCTCGAGCTTATGGATGTGATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153554.1-802s21c1
Sequence:CCGGCCCATCGTCAACACAAACGATCTCGAGATCGTTTGTGTTGACGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks