EMAIL THIS PAGE TO A FRIEND

ALDH1A1

aldehyde dehydrogenase 1 family, member A1

92 Gene Product Result for
Synonyms: ALDC ALDH-E1 ALDH1 ALDH11 PUMB1 RALDH1
UniProtKB ID: P00352, O00768, Q5SYR1
Gene ID:
Human(216) Summary: The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
Mouse(11668) aldehyde dehydrogenase family 1, subfamily A1
Rat(24188) aldehyde dehydrogenase 1 family, member A1
chicken(395264) aldehyde dehydrogenase 1 family, member A1
cow(281615) aldehyde dehydrogenase 1 family, member A1
domestic cat(101090397) aldehyde dehydrogenase 1 family, member A1
dog(476323) aldehyde dehydrogenase 1 family, member A1
naked mole-rat(101706446) aldehyde dehydrogenase 1 family, member A1
domestic guinea pig(100732581) aldehyde dehydrogenase 1 family, member A1
sheep(443343) aldehyde dehydrogenase 1 family, member A1
Domestic Rabbit(100008636) aldehyde dehydrogenase 1 family, member A1
Gene Class: Apoptosis, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500059 Anti-ALDH1A1 (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405445 Anti-ALDH1A1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108384 Anti-ALDH1A1 antibody produced in rabbit affinity isolated antibody yeast, horse, rabbit, guinea pig, human
immunohistochemistry, western blot pricing
HPA002123 Anti-ALDH1A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106201 Anti-ALDH1A1 antibody produced in rabbit affinity isolated antibody, lyophilized powder yeast, horse, human, rabbit
western blot pricing
SAB2500058 Anti-ALDH1A1, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
WH0000216M1 Monoclonal Anti-ALDH1A1 antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403542 Monoclonal Anti-ALDH1A1 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB5300519 Monoclonal Anti-ALDH1A1 antibody produced in mouse clone 5A11, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Crosslinker

Product # Description Species Add to Cart
 
C0768 Cyclophosphamide monohydrate bulk package human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1256 Human ALDH1A1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028501 MISSION® esiRNA esiRNA human ALDH1A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000689 Rosetta Predictions human pricing
NM_022407 Rosetta Predictions rat pricing
NM_013467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244055 predicted 750
2 SASI_Hs01_00244056 predicted 391
3 SASI_Hs02_00303091 predicted 1225
4 SASI_Hs01_00244057 predicted 1352
5 SASI_Hs01_00244058 predicted 514
6 SASI_Hs02_00303092 predicted 1112
7 SASI_Hs01_00244059 predicted 807
8 SASI_Hs01_00244061 predicted 1409
9 SASI_Hs01_00244063 predicted 903
10 SASI_Hs01_00244064 predicted 549
11 SASI_Hs01_00244060 predicted 538
12 SASI_Hs01_00244062 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049024 predicted 389
2 SASI_Rn01_00049025 predicted 437
3 SASI_Rn01_00049026 predicted 1378
4 SASI_Rn01_00049027 predicted 444
5 SASI_Rn01_00049028 predicted 1525
6 SASI_Rn01_00049029 predicted 1571
7 SASI_Rn01_00049030 predicted 1470
8 SASI_Rn01_00049031 predicted 966
9 SASI_Rn01_00049032 predicted 756
10 SASI_Rn01_00049033 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044509 predicted 442
2 SASI_Mm01_00044510 predicted 392
3 SASI_Mm01_00044511 predicted 544
4 SASI_Mm01_00044512 predicted 371
5 SASI_Mm01_00044513 predicted 1162
6 SASI_Mm01_00044514 predicted 346
7 SASI_Mm01_00044515 predicted 105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013467
VALIDATED
ALDH1A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-1506s21c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-549s21c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-392s21c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013467.3-1728s21c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1742s1c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1020s1c1
Sequence:CCGGCGAGCTAAGAAATATGTTCTTCTCGAGAAGAACATATTTCTTAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-406s1c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1520s1c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-563s1c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013467
VALIDATED
ALDH1A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-1506s21c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-549s21c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-392s21c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013467.3-1728s21c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1742s1c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1020s1c1
Sequence:CCGGCGAGCTAAGAAATATGTTCTTCTCGAGAAGAACATATTTCTTAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-406s1c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1520s1c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-563s1c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013467
VALIDATED
ALDH1A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-1506s21c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-549s21c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013467.3-392s21c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013467.3-1728s21c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1742s1c1
Sequence:CCGGCCCAGTTCTTATCCAAGAATACTCGAGTATTCTTGGATAAGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1020s1c1
Sequence:CCGGCGAGCTAAGAAATATGTTCTTCTCGAGAAGAACATATTTCTTAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-406s1c1
Sequence:CCGGCGGATTTAGGAGGCTGCATAACTCGAGTTATGCAGCCTCCTAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-1520s1c1
Sequence:CCGGCGCAATGAAGATATCTCAGAACTCGAGTTCTGAGATATCTTCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013467.1-563s1c1
Sequence:CCGGGCTCATGTTCATTTGGAAGATCTCGAGATCTTCCAAATGAACATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000689
VALIDATED
ALDH1A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-92s21c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-330s21c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-566s21c1
Sequence:CCGGCCCGTTGGTTATGCTCATTTGCTCGAGCAAATGAGCATAACCAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-1809s21c1
Sequence:CCGGCTCTAGCTTTGTCATAGTTATCTCGAGATAACTATGACAAAGCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-544s21c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-330s1c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-544s1c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-1502s1c1
Sequence:CCGGCCATGAATATACAGAGGTCAACTCGAGTTGACCTCTGTATATTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-92s1c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-1029s1c1
Sequence:CCGGCGGGCTAAGAAGTATATCCTTCTCGAGAAGGATATACTTCTTAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000689
VALIDATED
ALDH1A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-92s21c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-330s21c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-566s21c1
Sequence:CCGGCCCGTTGGTTATGCTCATTTGCTCGAGCAAATGAGCATAACCAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-1809s21c1
Sequence:CCGGCTCTAGCTTTGTCATAGTTATCTCGAGATAACTATGACAAAGCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-544s21c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-330s1c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-544s1c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-1502s1c1
Sequence:CCGGCCATGAATATACAGAGGTCAACTCGAGTTGACCTCTGTATATTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-92s1c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-1029s1c1
Sequence:CCGGCGGGCTAAGAAGTATATCCTTCTCGAGAAGGATATACTTCTTAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000689
VALIDATED
ALDH1A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-92s21c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-330s21c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-566s21c1
Sequence:CCGGCCCGTTGGTTATGCTCATTTGCTCGAGCAAATGAGCATAACCAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276397    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-1809s21c1
Sequence:CCGGCTCTAGCTTTGTCATAGTTATCTCGAGATAACTATGACAAAGCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000689.3-544s21c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-330s1c1
Sequence:CCGGGCTGATTTAATCGAAAGAGATCTCGAGATCTCTTTCGATTAAATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-544s1c1
Sequence:CCGGGCCAAATCATTCCTTGGAATTCTCGAGAATTCCAAGGAATGATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-1502s1c1
Sequence:CCGGCCATGAATATACAGAGGTCAACTCGAGTTGACCTCTGTATATTCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000689.3-92s1c1
Sequence:CCGGCACCGATTTGAAGATTCAATACTCGAGTATTGAATCTTCAAATCGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000689.3-1029s1c1
Sequence:CCGGCGGGCTAAGAAGTATATCCTTCTCGAGAAGGATATACTTCTTAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)