EMAIL THIS PAGE TO A FRIEND

ALDH1A2

aldehyde dehydrogenase 1 family, member A2

Synonyms: RALDH(II) RALDH2 RALDH2-T
Gene ID:
Human(8854) Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
Mouse(19378) aldehyde dehydrogenase family 1, subfamily A2
Rat(116676) aldehyde dehydrogenase 1 family, member A2
sheep(101117509) aldehyde dehydrogenase 1 family, member A2
Domestic Rabbit(100339014) aldehyde dehydrogenase 1 family, member A2
domestic guinea pig(100718164) aldehyde dehydrogenase 1 family, member A2
naked mole-rat(101699741) aldehyde dehydrogenase 1 family, member A2
Zebrafish(116713) aldehyde dehydrogenase 1 family, member A2
chicken(395844) aldehyde dehydrogenase 1 family, member A2
cow(535075) aldehyde dehydrogenase 1 family, member A2
Horse(100054550) aldehyde dehydrogenase 1 family, member A2
domestic cat(101082916) aldehyde dehydrogenase 1 family, member A2
dog(478319) aldehyde dehydrogenase 1 family, member A2
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003888 Rosetta Predictions human pricing
NM_170696 Rosetta Predictions human pricing
NM_170697 Rosetta Predictions human pricing
NM_053896 Rosetta Predictions rat pricing
NM_009022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076029 predicted 1331
2 SASI_Hs01_00076030 predicted 1544
3 SASI_Hs01_00076031 predicted 1453
4 SASI_Hs01_00076032 predicted 1904
5 SASI_Hs01_00076033 predicted 1353
6 SASI_Hs01_00076035 predicted 1461
7 SASI_Hs01_00076036 predicted 1806
8 SASI_Hs01_00076038 predicted 1783
9 SASI_Hs02_00336502 predicted 1282
10 SASI_Hs02_00336503 predicted 1567
11 SASI_Hs01_00076034 predicted 1630
12 SASI_Hs01_00076037 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154111 predicted 1214
2 SASI_Hs01_00154112 predicted 1423
3 SASI_Hs01_00154113 predicted 1335
4 SASI_Hs01_00154114 predicted 1791
5 SASI_Hs01_00154115 predicted 1236
6 SASI_Hs01_00154117 predicted 1347
7 SASI_Hs01_00154118 predicted 1695
8 SASI_Hs01_00154120 predicted 1668
9 SASI_Hs02_00367630 predicted 1160
10 SASI_Hs02_00367631 predicted 1450
11 SASI_Hs01_00154116 predicted 1519
12 SASI_Hs01_00154119 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015807 predicted 1088
2 SASI_Hs01_00015808 predicted 1296
3 SASI_Hs01_00015809 predicted 1209
4 SASI_Hs01_00015810 predicted 1659
5 SASI_Hs01_00015811 predicted 1107
6 SASI_Hs01_00015813 predicted 1227
7 SASI_Hs01_00015814 predicted 1564
8 SASI_Hs01_00015816 predicted 1545
9 SASI_Hs02_00367632 predicted 1038
10 SASI_Hs02_00367633 predicted 1332
11 SASI_Hs01_00015812 predicted 1386
12 SASI_Hs01_00015815 predicted 1552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089541 predicted 1474
2 SASI_Rn01_00089542 predicted 606
3 SASI_Rn01_00089544 predicted 607
4 SASI_Rn02_00266818 predicted 1088
5 SASI_Rn01_00089545 predicted 655
6 SASI_Rn01_00089546 predicted 1550
7 SASI_Rn01_00089547 predicted 360
8 SASI_Rn01_00089548 predicted 514
9 SASI_Rn01_00089549 predicted 661
10 SASI_Rn01_00089550 predicted 1403
11 SASI_Rn01_00089543 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050666 predicted 1464
2 SASI_Mm01_00050667 predicted 1170
3 SASI_Mm02_00315172 predicted 741
4 SASI_Mm01_00050668 predicted 1297
5 SASI_Mm01_00050669 predicted 599
6 SASI_Mm01_00050670 predicted 1551
7 SASI_Mm02_00315173 predicted 979
8 SASI_Mm01_00050671 predicted 370
9 SASI_Mm01_00050672 predicted 1396
10 SASI_Mm01_00050673 predicted 352
11 SASI_Mm01_00050665 predicted 1333
12 SASI_Mm01_00050674 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009022
ALDH1A2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000041933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-987s1c1
Sequence:CCGGGAATCCATCTATGAGGAATTTCTCGAGAAATTCCTCATAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-98s1c1
Sequence:CCGGCGAGATCAAGTACACCAAGATCTCGAGATCTTGGTGTACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-360s1c1
Sequence:CCGGGCAACTATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-1218s1c1
Sequence:CCGGGTCACTGATGACATGCGGATTCTCGAGAATCCGCATGTCATCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009022
ALDH1A2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000041933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-987s1c1
Sequence:CCGGGAATCCATCTATGAGGAATTTCTCGAGAAATTCCTCATAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-98s1c1
Sequence:CCGGCGAGATCAAGTACACCAAGATCTCGAGATCTTGGTGTACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-360s1c1
Sequence:CCGGGCAACTATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-1218s1c1
Sequence:CCGGGTCACTGATGACATGCGGATTCTCGAGAATCCGCATGTCATCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009022
ALDH1A2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000041933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-987s1c1
Sequence:CCGGGAATCCATCTATGAGGAATTTCTCGAGAAATTCCTCATAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-98s1c1
Sequence:CCGGCGAGATCAAGTACACCAAGATCTCGAGATCTTGGTGTACTTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-360s1c1
Sequence:CCGGGCAACTATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009022.2-1218s1c1
Sequence:CCGGGTCACTGATGACATGCGGATTCTCGAGAATCCGCATGTCATCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170697
VALIDATED
ALDH1A2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-178s1c1
Sequence:CCGGGCAACCATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-425s1c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170697.1-900s1c1
Sequence:CCGGCCAGATTGATAAGAAACAGTACTCGAGTACTGTTTCTTATCAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1106s1c1
Sequence:CCGGCGATGGATGAAGTTATCGAAACTCGAGTTTCGATAACTTCATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1213s1c1
Sequence:CCGGGCTGGGACTGTTTGGATCAATCTCGAGATTGATCCAAACAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-265s21c1
Sequence:CCGGTACGCAGGCTGGGCTGATAAACTCGAGTTTATCAGCCCAGCCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-2284s21c1
Sequence:CCGGTCTAATATTGGGCAACAATTACTCGAGTAATTGTTGCCCAATATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-425s21c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-303s21c1
Sequence:CCGGTCCTGTAGATGGAGACTATTTCTCGAGAAATAGTCTCCATCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170697
VALIDATED
ALDH1A2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-178s1c1
Sequence:CCGGGCAACCATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-425s1c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170697.1-900s1c1
Sequence:CCGGCCAGATTGATAAGAAACAGTACTCGAGTACTGTTTCTTATCAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1106s1c1
Sequence:CCGGCGATGGATGAAGTTATCGAAACTCGAGTTTCGATAACTTCATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1213s1c1
Sequence:CCGGGCTGGGACTGTTTGGATCAATCTCGAGATTGATCCAAACAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-265s21c1
Sequence:CCGGTACGCAGGCTGGGCTGATAAACTCGAGTTTATCAGCCCAGCCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-2284s21c1
Sequence:CCGGTCTAATATTGGGCAACAATTACTCGAGTAATTGTTGCCCAATATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-425s21c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-303s21c1
Sequence:CCGGTCCTGTAGATGGAGACTATTTCTCGAGAAATAGTCTCCATCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170697
VALIDATED
ALDH1A2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-178s1c1
Sequence:CCGGGCAACCATGGAATCCCTAAATCTCGAGATTTAGGGATTCCATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-425s1c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170697.1-900s1c1
Sequence:CCGGCCAGATTGATAAGAAACAGTACTCGAGTACTGTTTCTTATCAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1106s1c1
Sequence:CCGGCGATGGATGAAGTTATCGAAACTCGAGTTTCGATAACTTCATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_170697.1-1213s1c1
Sequence:CCGGGCTGGGACTGTTTGGATCAATCTCGAGATTGATCCAAACAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-265s21c1
Sequence:CCGGTACGCAGGCTGGGCTGATAAACTCGAGTTTATCAGCCCAGCCTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-2284s21c1
Sequence:CCGGTCTAATATTGGGCAACAATTACTCGAGTAATTGTTGCCCAATATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-425s21c1
Sequence:CCGGGTGGCAATACAGTAGTTATTACTCGAGTAATAACTACTGTATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_170697.1-303s21c1
Sequence:CCGGTCCTGTAGATGGAGACTATTTCTCGAGAAATAGTCTCCATCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks