EMAIL THIS PAGE TO A FRIEND

ALDH1A3

aldehyde dehydrogenase 1 family, member A3

Synonyms: ALDH1A6 ALDH6 MCOP8 RALDH3
UniProtKB ID: P47895, Q6NT64
Gene ID:
Human(220) Summary: Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The enzyme encoded by this gene uses retinal as a substrate, either in a free or cellular retinol-binding protein form. [provided by RefSeq, Jul 2008]
Mouse(56847) aldehyde dehydrogenase family 1, subfamily A3
Rat(266603) aldehyde dehydrogenase 1 family, member A3
Zebrafish(751785) aldehyde dehydrogenase 1 family, member A3
chicken(395389) aldehyde dehydrogenase 1 family, member A3
dog(100684466) aldehyde dehydrogenase 1 family, member A3
domestic cat(101081050) aldehyde dehydrogenase 1 family, member A3
cow(507093) aldehyde dehydrogenase 1 family, member A3
Horse(100057072) aldehyde dehydrogenase 1 family, member A3
naked mole-rat(101700669) aldehyde dehydrogenase 1 family, member A3
domestic guinea pig(100716195) aldehyde dehydrogenase 1 family, member A3
sheep(101109831) aldehyde dehydrogenase 1 family, member A3
Gene Class: Dehydrogenase
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000693 Rosetta Predictions human pricing
NM_153300 Rosetta Predictions rat pricing
NM_053080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129096 predicted 264
2 SASI_Hs01_00129097 predicted 1564
3 SASI_Hs01_00129098 predicted 1587
4 SASI_Hs01_00129099 predicted 291
5 SASI_Hs02_00303098 predicted 1451
6 SASI_Hs01_00129100 predicted 1521
7 SASI_Hs02_00303099 predicted 1304
8 SASI_Hs01_00129101 predicted 1607
9 SASI_Hs01_00129102 predicted 831
10 SASI_Hs01_00129103 predicted 1344
11 SASI_Hs01_00129104 predicted 1463
12 SASI_Hs01_00129105 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036583 predicted 1234
2 SASI_Rn01_00036584 predicted 1286
3 SASI_Rn01_00036585 predicted 638
4 SASI_Rn01_00036586 predicted 400
5 SASI_Rn01_00036587 predicted 591
6 SASI_Rn01_00036588 predicted 634
7 SASI_Rn01_00036589 predicted 853
8 SASI_Rn01_00036590 predicted 293
9 SASI_Rn01_00036591 predicted 304
10 SASI_Rn01_00036592 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075081 predicted 1713
2 SASI_Mm01_00075082 predicted 1851
3 SASI_Mm01_00075084 predicted 1548
4 SASI_Mm02_00337567 predicted 259
5 SASI_Mm01_00075085 predicted 1535
6 SASI_Mm02_00337568 predicted 198
7 SASI_Mm01_00075087 predicted 1449
8 SASI_Mm01_00075088 predicted 1776
9 SASI_Mm01_00075089 predicted 907
10 SASI_Mm01_00075090 predicted 1762
11 SASI_Mm01_00075083 predicted 1263
12 SASI_Mm01_00075086 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000693
VALIDATED
ALDH1A3 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000693.2-1396s21c1
Sequence:CCGGGAGCGAATAGCACCGACTATGCTCGAGCATAGTCGGTGCTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1961s21c1
Sequence:CCGGTGTCCAGCAGTTGCTTGAAATCTCGAGATTTCAAGCAACTGCTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1921s21c1
Sequence:CCGGAGATACTCAGGGCGTTGTTAACTCGAGTTAACAACGCCCTGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-522s1c1
Sequence:CCGGCCACAGATGACAACGTCGTATCTCGAGATACGACGTTGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-1535s1c1
Sequence:CCGGGCCGAATACACAGAAGTGAAACTCGAGTTTCACTTCTGTGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-459s1c1
Sequence:CCGGGCTGTATTAGAACCCTCAGATCTCGAGATCTGAGGGTTCTAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1300s1c1
Sequence:CCGGGCAACCAATACTGAAGTTCAACTCGAGTTGAACTTCAGTATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1022s1c1
Sequence:CCGGGAGCAGGTCTACTCTGAGTTTCTCGAGAAACTCAGAGTAGACCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000693
VALIDATED
ALDH1A3 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000693.2-1396s21c1
Sequence:CCGGGAGCGAATAGCACCGACTATGCTCGAGCATAGTCGGTGCTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1961s21c1
Sequence:CCGGTGTCCAGCAGTTGCTTGAAATCTCGAGATTTCAAGCAACTGCTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1921s21c1
Sequence:CCGGAGATACTCAGGGCGTTGTTAACTCGAGTTAACAACGCCCTGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-522s1c1
Sequence:CCGGCCACAGATGACAACGTCGTATCTCGAGATACGACGTTGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-1535s1c1
Sequence:CCGGGCCGAATACACAGAAGTGAAACTCGAGTTTCACTTCTGTGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-459s1c1
Sequence:CCGGGCTGTATTAGAACCCTCAGATCTCGAGATCTGAGGGTTCTAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1300s1c1
Sequence:CCGGGCAACCAATACTGAAGTTCAACTCGAGTTGAACTTCAGTATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1022s1c1
Sequence:CCGGGAGCAGGTCTACTCTGAGTTTCTCGAGAAACTCAGAGTAGACCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000693
VALIDATED
ALDH1A3 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000693.2-1396s21c1
Sequence:CCGGGAGCGAATAGCACCGACTATGCTCGAGCATAGTCGGTGCTATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1961s21c1
Sequence:CCGGTGTCCAGCAGTTGCTTGAAATCTCGAGATTTCAAGCAACTGCTGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000693.2-1921s21c1
Sequence:CCGGAGATACTCAGGGCGTTGTTAACTCGAGTTAACAACGCCCTGAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-522s1c1
Sequence:CCGGCCACAGATGACAACGTCGTATCTCGAGATACGACGTTGTCATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-1535s1c1
Sequence:CCGGGCCGAATACACAGAAGTGAAACTCGAGTTTCACTTCTGTGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000693.1-459s1c1
Sequence:CCGGGCTGTATTAGAACCCTCAGATCTCGAGATCTGAGGGTTCTAATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1300s1c1
Sequence:CCGGGCAACCAATACTGAAGTTCAACTCGAGTTGAACTTCAGTATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000693.1-1022s1c1
Sequence:CCGGGAGCAGGTCTACTCTGAGTTTCTCGAGAAACTCAGAGTAGACCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053080
ALDH1A3 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-796s1c1
Sequence:CCGGGCAGATCAACAAGATAGCCTTCTCGAGAAGGCTATCTTGTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-175s1c1
Sequence:CCGGCGAATCCAAGAGTGGAAGAAACTCGAGTTTCTTCCACTCTTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1535s1c1
Sequence:CCGGGCTGAATATACAGAAGTGAAACTCGAGTTTCACTTCTGTATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1236s1c1
Sequence:CCGGCCACGGTCTTCTCAGATGTTACTCGAGTAACATCTGAGAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-448s1c1
Sequence:CCGGCGACCTGGAAGGCTGTATTAACTCGAGTTAATACAGCCTTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053080
ALDH1A3 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-796s1c1
Sequence:CCGGGCAGATCAACAAGATAGCCTTCTCGAGAAGGCTATCTTGTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-175s1c1
Sequence:CCGGCGAATCCAAGAGTGGAAGAAACTCGAGTTTCTTCCACTCTTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1535s1c1
Sequence:CCGGGCTGAATATACAGAAGTGAAACTCGAGTTTCACTTCTGTATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1236s1c1
Sequence:CCGGCCACGGTCTTCTCAGATGTTACTCGAGTAACATCTGAGAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-448s1c1
Sequence:CCGGCGACCTGGAAGGCTGTATTAACTCGAGTTAATACAGCCTTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053080
ALDH1A3 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-796s1c1
Sequence:CCGGGCAGATCAACAAGATAGCCTTCTCGAGAAGGCTATCTTGTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-175s1c1
Sequence:CCGGCGAATCCAAGAGTGGAAGAAACTCGAGTTTCTTCCACTCTTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1535s1c1
Sequence:CCGGGCTGAATATACAGAAGTGAAACTCGAGTTTCACTTCTGTATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-1236s1c1
Sequence:CCGGCCACGGTCTTCTCAGATGTTACTCGAGTAACATCTGAGAAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053080.2-448s1c1
Sequence:CCGGCGACCTGGAAGGCTGTATTAACTCGAGTTAATACAGCCTTCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks