EMAIL THIS PAGE TO A FRIEND

ALDH1B1

aldehyde dehydrogenase 1 family, member B1

100 Gene Product Result for
Synonyms: ALDH5 ALDHX
UniProtKB ID: P30837, B2R8F0, Q8WX76, Q9BV45
Gene ID:
Human(219) Summary: This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
Mouse(72535) aldehyde dehydrogenase 1 family, member B1
Rat(298079) aldehyde dehydrogenase 1 family, member B1
naked mole-rat(101701236) aldehyde dehydrogenase 1 family, member B1
domestic guinea pig(100734441) aldehyde dehydrogenase 1 family, member B1
sheep(101105060) aldehyde dehydrogenase 1 family, member B1
Horse(100055111) aldehyde dehydrogenase 1 family, member B1
dog(481620) aldehyde dehydrogenase 1 family, member B1
domestic cat(101081838) aldehyde dehydrogenase 1 family, member B1
cow(281618) aldehyde dehydrogenase 1 family, member B1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Crosslinker

Product # Description Species Add to Cart
 
C0768 Cyclophosphamide monohydrate bulk package human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000692 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024151 MISSION® esiRNA esiRNA human ALDH1B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000692 Rosetta Predictions human pricing
NM_001011975 Rosetta Predictions rat pricing
XM_575817 Rosetta Predictions rat pricing
NM_028270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186297 predicted 1220
2 SASI_Hs01_00186299 predicted 1598
3 SASI_Hs01_00186300 predicted 1697
4 SASI_Hs01_00186301 predicted 1742
5 SASI_Hs01_00186302 predicted 529
6 SASI_Hs02_00303095 predicted 1089
7 SASI_Hs01_00186303 predicted 1637
8 SASI_Hs02_00303096 predicted 501
9 SASI_Hs01_00186304 predicted 1330
10 SASI_Hs02_00303097 predicted 1709
11 SASI_Hs01_00186295 predicted 1551
12 SASI_Hs01_00186296 predicted 1095
13 SASI_Hs01_00186298 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041297 predicted 532
2 SASI_Rn01_00041298 predicted 504
3 SASI_Rn01_00041299 predicted 1570
4 SASI_Rn01_00041300 predicted 565
5 SASI_Rn01_00041301 predicted 1275
6 SASI_Rn01_00041302 predicted 1522
7 SASI_Rn02_00199997 predicted 1133
8 SASI_Rn01_00041303 predicted 1713
9 SASI_Rn01_00041304 predicted 1289
10 SASI_Rn01_00041306 predicted 1066
11 SASI_Rn01_00041305 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194506 predicted 899
2 SASI_Rn01_00194507 predicted 831
3 SASI_Rn01_00194508 predicted 287
4 SASI_Rn01_00194509 predicted 269
5 SASI_Rn01_00194510 predicted 821
6 SASI_Rn01_00194511 predicted 270
7 SASI_Rn01_00194512 predicted 734
8 SASI_Rn01_00194513 predicted 774
9 SASI_Rn01_00194514 predicted 302
10 SASI_Rn01_00194515 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068299 predicted 578
2 SASI_Mm01_00068300 predicted 1698
3 SASI_Mm01_00068301 predicted 1608
4 SASI_Mm01_00068302 predicted 249
5 SASI_Mm01_00068303 predicted 642
6 SASI_Mm01_00068304 predicted 1804
7 SASI_Mm01_00068305 predicted 488
8 SASI_Mm01_00068306 predicted 380
9 SASI_Mm01_00068307 predicted 1143
10 SASI_Mm01_00068308 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028270
ALDH1B1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member B1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1565s21c1
Sequence:CCGGGTGTGGGTGAACACCTATAACCTCGAGGTTATAGGTGTTCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1599s21c1
Sequence:CCGGACACGCCATTCGGAGGCTTTACTCGAGTAAAGCCTCCGAATGGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-587s21c1
Sequence:CCGGGTCATCAAGGTGTACCGTTACCTCGAGGTAACGGTACACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028270.2-1891s1c1
Sequence:CCGGCCCACCTCTCTGATGAGTTATCTCGAGATAACTCATCAGAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-462s1c1
Sequence:CCGGGCTGATCTTGTGGAACGAGATCTCGAGATCTCGTTCCACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-230s1c1
Sequence:CCGGCCCAGAGATTTGCTACAACAACTCGAGTTGTTGTAGCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-605s1c2
Sequence:CCGGGCATGGTAAGACCATCCCTATCTCGAGATAGGGATGGTCTTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028270
ALDH1B1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member B1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1565s21c1
Sequence:CCGGGTGTGGGTGAACACCTATAACCTCGAGGTTATAGGTGTTCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1599s21c1
Sequence:CCGGACACGCCATTCGGAGGCTTTACTCGAGTAAAGCCTCCGAATGGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-587s21c1
Sequence:CCGGGTCATCAAGGTGTACCGTTACCTCGAGGTAACGGTACACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028270.2-1891s1c1
Sequence:CCGGCCCACCTCTCTGATGAGTTATCTCGAGATAACTCATCAGAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-462s1c1
Sequence:CCGGGCTGATCTTGTGGAACGAGATCTCGAGATCTCGTTCCACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-230s1c1
Sequence:CCGGCCCAGAGATTTGCTACAACAACTCGAGTTGTTGTAGCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-605s1c2
Sequence:CCGGGCATGGTAAGACCATCCCTATCTCGAGATAGGGATGGTCTTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028270
ALDH1B1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member B1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1565s21c1
Sequence:CCGGGTGTGGGTGAACACCTATAACCTCGAGGTTATAGGTGTTCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-1599s21c1
Sequence:CCGGACACGCCATTCGGAGGCTTTACTCGAGTAAAGCCTCCGAATGGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028270.4-587s21c1
Sequence:CCGGGTCATCAAGGTGTACCGTTACCTCGAGGTAACGGTACACCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028270.2-1891s1c1
Sequence:CCGGCCCACCTCTCTGATGAGTTATCTCGAGATAACTCATCAGAGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-462s1c1
Sequence:CCGGGCTGATCTTGTGGAACGAGATCTCGAGATCTCGTTCCACAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-230s1c1
Sequence:CCGGCCCAGAGATTTGCTACAACAACTCGAGTTGTTGTAGCAAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028270.2-605s1c2
Sequence:CCGGGCATGGTAAGACCATCCCTATCTCGAGATAGGGATGGTCTTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000692
VALIDATED
ALDH1B1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member B1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1119s21c1
Sequence:CCGGTCGAGAGAACCGTGGAGAAAGCTCGAGCTTTCTCCACGGTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000692.3-540s21c1
Sequence:CCGGTCAAGGTGTATCGGTACTTTGCTCGAGCAAAGTACCGATACACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1097s21c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1550s21c1
Sequence:CCGGACGCCATTTGGAGGGTTTAAGCTCGAGCTTAAACCCTCCAAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000692.3-2067s21c1
Sequence:CCGGTTGAACTAGGTGGATACTAAACTCGAGTTTAGTATCCACCTAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1097s1c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000692.3-484s1c1
Sequence:CCGGCTTGGACAATGGGAAGCCTTTCTCGAGAAAGGCTTCCCATTGTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1513s1c1
Sequence:CCGGCGTGTGGGTAAACACCTACAACTCGAGTTGTAGGTGTTTACCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1327s1c1
Sequence:CCGGCGTGCAGGATGACATGAGAATCTCGAGATTCTCATGTCATCCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000692
VALIDATED
ALDH1B1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member B1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1119s21c1
Sequence:CCGGTCGAGAGAACCGTGGAGAAAGCTCGAGCTTTCTCCACGGTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000692.3-540s21c1
Sequence:CCGGTCAAGGTGTATCGGTACTTTGCTCGAGCAAAGTACCGATACACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1097s21c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1550s21c1
Sequence:CCGGACGCCATTTGGAGGGTTTAAGCTCGAGCTTAAACCCTCCAAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000692.3-2067s21c1
Sequence:CCGGTTGAACTAGGTGGATACTAAACTCGAGTTTAGTATCCACCTAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1097s1c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000692.3-484s1c1
Sequence:CCGGCTTGGACAATGGGAAGCCTTTCTCGAGAAAGGCTTCCCATTGTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1513s1c1
Sequence:CCGGCGTGTGGGTAAACACCTACAACTCGAGTTGTAGGTGTTTACCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1327s1c1
Sequence:CCGGCGTGCAGGATGACATGAGAATCTCGAGATTCTCATGTCATCCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000692
VALIDATED
ALDH1B1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member B1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1119s21c1
Sequence:CCGGTCGAGAGAACCGTGGAGAAAGCTCGAGCTTTCTCCACGGTTCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000692.3-540s21c1
Sequence:CCGGTCAAGGTGTATCGGTACTTTGCTCGAGCAAAGTACCGATACACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1097s21c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000692.3-1550s21c1
Sequence:CCGGACGCCATTTGGAGGGTTTAAGCTCGAGCTTAAACCCTCCAAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000692.3-2067s21c1
Sequence:CCGGTTGAACTAGGTGGATACTAAACTCGAGTTTAGTATCCACCTAGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1097s1c1
Sequence:CCGGGAATCCATCTACAATGAGTTTCTCGAGAAACTCATTGTAGATGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000692.3-484s1c1
Sequence:CCGGCTTGGACAATGGGAAGCCTTTCTCGAGAAAGGCTTCCCATTGTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1513s1c1
Sequence:CCGGCGTGTGGGTAAACACCTACAACTCGAGTTGTAGGTGTTTACCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000692.3-1327s1c1
Sequence:CCGGCGTGCAGGATGACATGAGAATCTCGAGATTCTCATGTCATCCTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks