EMAIL THIS PAGE TO A FRIEND

ALDH1L1

aldehyde dehydrogenase 1 family, member L1

Synonyms: 10-FTHFDH 10-fTHF FDH FTHFD
UniProtKB ID: O75891, B4DG36, E9PBX3, Q68CS1
Gene ID:
Human(10840) Summary: The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(107747) aldehyde dehydrogenase 1 family, member L1
Rat(64392) aldehyde dehydrogenase 1 family, member L1
Zebrafish(100526683) aldehyde dehydrogenase 1 family, member L1
domestic cat(101091432) aldehyde dehydrogenase 1 family, member L1
dog(476506) aldehyde dehydrogenase 1 family, member L1
cow(505677) aldehyde dehydrogenase 1 family, member L1
sheep(100913154) aldehyde dehydrogenase 1 family, member L1
domestic guinea pig(100730205) aldehyde dehydrogenase 1 family, member L1
naked mole-rat(101709289) aldehyde dehydrogenase 1 family, member L1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012190 Rosetta Predictions human pricing
NM_022547 Rosetta Predictions rat pricing
NM_027406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106766 predicted 270
2 SASI_Hs01_00106767 predicted 213
3 SASI_Hs01_00106768 predicted 1779
4 SASI_Hs02_00343820 predicted 2897
5 SASI_Hs01_00106772 predicted 538
6 SASI_Hs01_00106773 predicted 2227
7 SASI_Hs01_00106774 predicted 2168
8 SASI_Hs01_00106775 predicted 223
9 SASI_Hs02_00343821 predicted 2693
10 SASI_Hs02_00343822 predicted 673
11 SASI_Hs01_00106769 predicted 1200
12 SASI_Hs01_00106770 predicted 1325
13 SASI_Hs01_00106771 predicted 2002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051328 predicted 900
2 SASI_Rn01_00051329 predicted 1183
3 SASI_Rn01_00051330 predicted 1754
4 SASI_Rn01_00051331 predicted 1875
5 SASI_Rn01_00051332 predicted 195
6 SASI_Rn01_00051333 predicted 2390
7 SASI_Rn01_00051334 predicted 509
8 SASI_Rn01_00051335 predicted 2023
9 SASI_Rn01_00051336 predicted 2437
10 SASI_Rn01_00051337 predicted 2856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186035 predicted 1861
2 SASI_Mm01_00186036 predicted 1171
3 SASI_Mm01_00186037 predicted 1153
4 SASI_Mm01_00186038 predicted 994
5 SASI_Mm01_00186039 predicted 2610
6 SASI_Mm01_00186040 predicted 491
7 SASI_Mm01_00186041 predicted 1353
8 SASI_Mm01_00186043 predicted 2848
9 SASI_Mm01_00186044 predicted 2416
10 SASI_Mm02_00332129 predicted 1501
11 SASI_Mm01_00186042 predicted 2016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144776
ALDH1L1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member L1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1411s1c1
Sequence:CCGGCTACGTGGAAATGGCAGTGAACTCGAGTTCACTGCCATTTCCACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-901s1c1
Sequence:CCGGCTGTGAACAGAAACTGACATTCTCGAGAATGTCAGTTTCTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1090s1c1
Sequence:CCGGCCTGGCCTCGAACTTCTTTAACTCGAGTTAAAGAAGTTCGAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-553s1c1
Sequence:CCGGGACCCTCATTCACGGAGATAACTCGAGTTATCTCCGTGAATGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1019s1c1
Sequence:CCGGCTCATCCTCTTTGGGAATGATCTCGAGATCATTCCCAAAGAGGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144776
ALDH1L1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member L1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1411s1c1
Sequence:CCGGCTACGTGGAAATGGCAGTGAACTCGAGTTCACTGCCATTTCCACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-901s1c1
Sequence:CCGGCTGTGAACAGAAACTGACATTCTCGAGAATGTCAGTTTCTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1090s1c1
Sequence:CCGGCCTGGCCTCGAACTTCTTTAACTCGAGTTAAAGAAGTTCGAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-553s1c1
Sequence:CCGGGACCCTCATTCACGGAGATAACTCGAGTTATCTCCGTGAATGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1019s1c1
Sequence:CCGGCTCATCCTCTTTGGGAATGATCTCGAGATCATTCCCAAAGAGGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144776
ALDH1L1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member L1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1411s1c1
Sequence:CCGGCTACGTGGAAATGGCAGTGAACTCGAGTTCACTGCCATTTCCACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-901s1c1
Sequence:CCGGCTGTGAACAGAAACTGACATTCTCGAGAATGTCAGTTTCTGTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1090s1c1
Sequence:CCGGCCTGGCCTCGAACTTCTTTAACTCGAGTTAAAGAAGTTCGAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-553s1c1
Sequence:CCGGGACCCTCATTCACGGAGATAACTCGAGTTATCTCCGTGAATGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144776.1-1019s1c1
Sequence:CCGGCTCATCCTCTTTGGGAATGATCTCGAGATCATTCCCAAAGAGGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027406
VALIDATED
ALDH1L1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member L1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2713s1c1
Sequence:CCGGGCACTGTGTTTGTCAACACATCTCGAGATGTGTTGACAAACACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2825s1c1
Sequence:CCGGGCGGATCAAGACTGTGACTTTCTCGAGAAAGTCACAGTCTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1452s1c1
Sequence:CCGGGCGAAGACCTACAGTACCATACTCGAGTATGGTACTGTAGGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1346s1c1
Sequence:CCGGCGAGAGCGAGTGTGTCATTAACTCGAGTTAATGACACACTCGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2622s1c1
Sequence:CCGGCGGGCCAATGCTACAGAATTTCTCGAGAAATTCTGTAGCATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1194s21c1
Sequence:CCGGTCAGGAGCTGCATCCGTAGATCTCGAGATCTACGGATGCAGCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1249s21c1
Sequence:CCGGGTGACGGGCTGGAGTTAGAAACTCGAGTTTCTAACTCCAGCCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027406
VALIDATED
ALDH1L1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member L1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2713s1c1
Sequence:CCGGGCACTGTGTTTGTCAACACATCTCGAGATGTGTTGACAAACACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2825s1c1
Sequence:CCGGGCGGATCAAGACTGTGACTTTCTCGAGAAAGTCACAGTCTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1452s1c1
Sequence:CCGGGCGAAGACCTACAGTACCATACTCGAGTATGGTACTGTAGGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1346s1c1
Sequence:CCGGCGAGAGCGAGTGTGTCATTAACTCGAGTTAATGACACACTCGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2622s1c1
Sequence:CCGGCGGGCCAATGCTACAGAATTTCTCGAGAAATTCTGTAGCATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1194s21c1
Sequence:CCGGTCAGGAGCTGCATCCGTAGATCTCGAGATCTACGGATGCAGCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1249s21c1
Sequence:CCGGGTGACGGGCTGGAGTTAGAAACTCGAGTTTCTAACTCCAGCCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027406
VALIDATED
ALDH1L1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member L1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2713s1c1
Sequence:CCGGGCACTGTGTTTGTCAACACATCTCGAGATGTGTTGACAAACACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2825s1c1
Sequence:CCGGGCGGATCAAGACTGTGACTTTCTCGAGAAAGTCACAGTCTTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1452s1c1
Sequence:CCGGGCGAAGACCTACAGTACCATACTCGAGTATGGTACTGTAGGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-1346s1c1
Sequence:CCGGCGAGAGCGAGTGTGTCATTAACTCGAGTTAATGACACACTCGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027406.1-2622s1c1
Sequence:CCGGCGGGCCAATGCTACAGAATTTCTCGAGAAATTCTGTAGCATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1194s21c1
Sequence:CCGGTCAGGAGCTGCATCCGTAGATCTCGAGATCTACGGATGCAGCTCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027406.1-1249s21c1
Sequence:CCGGGTGACGGGCTGGAGTTAGAAACTCGAGTTTCTAACTCCAGCCCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks