EMAIL THIS PAGE TO A FRIEND

ALDH1L2

aldehyde dehydrogenase 1 family, member L2

69 Gene Product Result for
Synonyms: mtFDH
UniProtKB ID: Q3SY69, Q3SY68, Q68D62, Q6AI55, Q8N922
Gene ID:
Human(160428) Summary: This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Mouse(216188) aldehyde dehydrogenase 1 family, member L2
Rat(299699) aldehyde dehydrogenase 1 family, member L2
Zebrafish(100333269) aldehyde dehydrogenase 1 family, member L2
cow(516864) aldehyde dehydrogenase 1 family, member L2
Horse(100053705) aldehyde dehydrogenase 1 family, member L2
domestic cat(101088592) aldehyde dehydrogenase 1 family, member L2
dog(474534) aldehyde dehydrogenase 1 family, member L2
chicken(418078) aldehyde dehydrogenase 1 family, member L2
naked mole-rat(101697075) aldehyde dehydrogenase 1 family, member L2
domestic guinea pig(100717976) aldehyde dehydrogenase 1 family, member L2
sheep(101114182) aldehyde dehydrogenase 1 family, member L2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153543 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153543 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153543 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027011 MISSION® esiRNA esiRNA human ALDH1L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034173 Rosetta Predictions human pricing
XM_927536 Rosetta Predictions human pricing
XM_001079663 Rosetta Predictions rat pricing
XM_235005 Rosetta Predictions rat pricing
NM_153543 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147032 predicted 559
2 SASI_Hs02_00308136 predicted 1812
3 SASI_Hs01_00147034 predicted 875
4 SASI_Hs02_00308137 predicted 1429
5 SASI_Hs01_00147035 predicted 2484
6 SASI_Hs02_00308138 predicted 1663
7 SASI_Hs01_00147036 predicted 1547
8 SASI_Hs01_00147037 predicted 538
9 SASI_Hs01_00147038 predicted 1212
10 SASI_Hs01_00147039 predicted 1339
11 SASI_Hs01_00147033 predicted 536
12 SASI_Hs01_00147040 predicted 1320
13 SASI_Hs01_00147041 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263196 predicted 987
2 SASI_Hs01_00263197 predicted 1533
3 SASI_Hs01_00263198 predicted 2644
4 SASI_Hs01_00263199 predicted 1720
5 SASI_Hs01_00263200 predicted 2618
6 SASI_Hs01_00263201 predicted 1655
7 SASI_Hs01_00263202 predicted 1312
8 SASI_Hs01_00263203 predicted 1451
9 SASI_Hs01_00263204 predicted 1419
10 SASI_Hs01_00263205 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365026 predicted 1589
2 SASI_Rn02_00365027 predicted 932
3 SASI_Rn02_00365028 predicted 309
4 SASI_Rn02_00365029 predicted 216
5 SASI_Rn02_00365030 predicted 700
6 SASI_Rn02_00365031 predicted 2205
7 SASI_Rn02_00365032 predicted 270
8 SASI_Rn02_00365033 predicted 2004
9 SASI_Rn02_00365034 predicted 440
10 SASI_Rn02_00365035 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388891 predicted 498
2 SASI_Rn02_00388892 predicted 1392
3 SASI_Rn02_00388893 predicted 859
4 SASI_Rn02_00388894 predicted 205
5 SASI_Rn02_00388895 predicted 624
6 SASI_Rn02_00388896 predicted 865
7 SASI_Rn02_00388897 predicted 341
8 SASI_Rn02_00388898 predicted 923
9 SASI_Rn02_00388899 predicted 1294
10 SASI_Rn02_00388900 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142277 predicted 1726
2 SASI_Mm01_00142279 predicted 2645
3 SASI_Mm01_00142280 predicted 1812
4 SASI_Mm02_00343308 predicted 1237
5 SASI_Mm01_00142281 predicted 2534
6 SASI_Mm01_00142282 predicted 593
7 SASI_Mm02_00343309 predicted 1411
8 SASI_Mm01_00142283 predicted 836
9 SASI_Mm01_00142284 predicted 1032
10 SASI_Mm01_00142285 predicted 399
11 SASI_Mm01_00142278 predicted 1265
12 SASI_Mm01_00142286 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034173
VALIDATED
ALDH1L2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member L2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2599s21c1
Sequence:CCGGGGAATCCTTTGGGCCTATTATCTCGAGATAATAGGCCCAAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2339s21c1
Sequence:CCGGGAATCCATCCACGACGAATTTCTCGAGAAATTCGTCGTGGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2878s21c1
Sequence:CCGGGACGGTGACACTGGAATATTACTCGAGTAATATTCCAGTGTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2214s21c1
Sequence:CCGGGTGGCAAGTCTCCACTTATAACTCGAGTTATAAGTGGAGACTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-192s21c1
Sequence:CCGGAGCTGAAGTTGGCACTAATTGCTCGAGCAATTAGTGCCAACTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-854s1c1
Sequence:CCGGCCTGGAGAACCACTGGAAATTCTCGAGAATTTCCAGTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-253s1c1
Sequence:CCGGGCTTCCTAAATGGAGGGTCAACTCGAGTTGACCCTCCATTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-1345s1c1
Sequence:CCGGGCCATACCAGTGTTTCATAAACTCGAGTTTATGAAACACTGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-390s1c1
Sequence:CCGGGCTCTATCATTTATCACCCATCTCGAGATGGGTGATAAATGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034173.1-1460s1c1
Sequence:CCGGGCGGATGTTGATAAAGCAGTACTCGAGTACTGCTTTATCAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034173
VALIDATED
ALDH1L2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member L2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2599s21c1
Sequence:CCGGGGAATCCTTTGGGCCTATTATCTCGAGATAATAGGCCCAAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2339s21c1
Sequence:CCGGGAATCCATCCACGACGAATTTCTCGAGAAATTCGTCGTGGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2878s21c1
Sequence:CCGGGACGGTGACACTGGAATATTACTCGAGTAATATTCCAGTGTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2214s21c1
Sequence:CCGGGTGGCAAGTCTCCACTTATAACTCGAGTTATAAGTGGAGACTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-192s21c1
Sequence:CCGGAGCTGAAGTTGGCACTAATTGCTCGAGCAATTAGTGCCAACTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-854s1c1
Sequence:CCGGCCTGGAGAACCACTGGAAATTCTCGAGAATTTCCAGTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-253s1c1
Sequence:CCGGGCTTCCTAAATGGAGGGTCAACTCGAGTTGACCCTCCATTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-1345s1c1
Sequence:CCGGGCCATACCAGTGTTTCATAAACTCGAGTTTATGAAACACTGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-390s1c1
Sequence:CCGGGCTCTATCATTTATCACCCATCTCGAGATGGGTGATAAATGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034173.1-1460s1c1
Sequence:CCGGGCGGATGTTGATAAAGCAGTACTCGAGTACTGCTTTATCAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034173
VALIDATED
ALDH1L2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member L2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2599s21c1
Sequence:CCGGGGAATCCTTTGGGCCTATTATCTCGAGATAATAGGCCCAAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2339s21c1
Sequence:CCGGGAATCCATCCACGACGAATTTCTCGAGAAATTCGTCGTGGATGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2878s21c1
Sequence:CCGGGACGGTGACACTGGAATATTACTCGAGTAATATTCCAGTGTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-2214s21c1
Sequence:CCGGGTGGCAAGTCTCCACTTATAACTCGAGTTATAAGTGGAGACTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034173.3-192s21c1
Sequence:CCGGAGCTGAAGTTGGCACTAATTGCTCGAGCAATTAGTGCCAACTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-854s1c1
Sequence:CCGGCCTGGAGAACCACTGGAAATTCTCGAGAATTTCCAGTGGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-253s1c1
Sequence:CCGGGCTTCCTAAATGGAGGGTCAACTCGAGTTGACCCTCCATTTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-1345s1c1
Sequence:CCGGGCCATACCAGTGTTTCATAAACTCGAGTTTATGAAACACTGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001034173.1-390s1c1
Sequence:CCGGGCTCTATCATTTATCACCCATCTCGAGATGGGTGATAAATGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034173.1-1460s1c1
Sequence:CCGGGCGGATGTTGATAAAGCAGTACTCGAGTACTGCTTTATCAACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153543
ALDH1L2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 1 family, member L2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2577s1c1
Sequence:CCGGGGTGTTGCAGAGAGCAAATAACTCGAGTTATTTGCTCTCTGCAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-3651s1c1
Sequence:CCGGCGGCCCTAAATTGATGAGATTCTCGAGAATCTCATCAATTTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-477s1c1
Sequence:CCGGGACACTAATCATGGGAGATAACTCGAGTTATCTCCCATGATTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-5030s1c1
Sequence:CCGGCGATACAACTAAACACACAAACTCGAGTTTGTGTGTTTAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-599s1c1
Sequence:CCGGCGCTTTATAACCGGTTCCTTTCTCGAGAAAGGAACCGGTTATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2509s1c1
Sequence:CCGGCTTGCCAAGGAGGAATCCTTTCTCGAGAAAGGATTCCTCCTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2635s1c1
Sequence:CCGGGACATCAACAAAGCCATGTATCTCGAGATACATGGCTTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153543
ALDH1L2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 1 family, member L2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2577s1c1
Sequence:CCGGGGTGTTGCAGAGAGCAAATAACTCGAGTTATTTGCTCTCTGCAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-3651s1c1
Sequence:CCGGCGGCCCTAAATTGATGAGATTCTCGAGAATCTCATCAATTTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-477s1c1
Sequence:CCGGGACACTAATCATGGGAGATAACTCGAGTTATCTCCCATGATTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-5030s1c1
Sequence:CCGGCGATACAACTAAACACACAAACTCGAGTTTGTGTGTTTAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-599s1c1
Sequence:CCGGCGCTTTATAACCGGTTCCTTTCTCGAGAAAGGAACCGGTTATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2509s1c1
Sequence:CCGGCTTGCCAAGGAGGAATCCTTTCTCGAGAAAGGATTCCTCCTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2635s1c1
Sequence:CCGGGACATCAACAAAGCCATGTATCTCGAGATACATGGCTTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153543
ALDH1L2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 1 family, member L2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2577s1c1
Sequence:CCGGGGTGTTGCAGAGAGCAAATAACTCGAGTTATTTGCTCTCTGCAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-3651s1c1
Sequence:CCGGCGGCCCTAAATTGATGAGATTCTCGAGAATCTCATCAATTTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-477s1c1
Sequence:CCGGGACACTAATCATGGGAGATAACTCGAGTTATCTCCCATGATTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153543.1-5030s1c1
Sequence:CCGGCGATACAACTAAACACACAAACTCGAGTTTGTGTGTTTAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153543.1-599s1c1
Sequence:CCGGCGCTTTATAACCGGTTCCTTTCTCGAGAAAGGAACCGGTTATAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2509s1c1
Sequence:CCGGCTTGCCAAGGAGGAATCCTTTCTCGAGAAAGGATTCCTCCTTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153543.1-2635s1c1
Sequence:CCGGGACATCAACAAAGCCATGTATCTCGAGATACATGGCTTTGTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks