EMAIL THIS PAGE TO A FRIEND

ALDH3A1

aldehyde dehydrogenase 3 family, member A1

75 Gene Product Result for
Synonyms: ALDH3 ALDHIII
UniProtKB ID: P30838, A8K828, Q9BT37
Gene ID:
Human(218) Summary: Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
Mouse(11670) aldehyde dehydrogenase family 3, subfamily A1
Rat(25375) aldehyde dehydrogenase 3 family, member A1
dog(489526) aldehyde dehydrogenase 3 family, member A1
cow(281617) aldehyde dehydrogenase 3 family, member A1
domestic cat(101096364) aldehyde dehydrogenase 3 family, member A1
naked mole-rat(101699453) aldehyde dehydrogenase 3 family, member A1
domestic guinea pig(100729236) aldehyde dehydrogenase 3 family, member A1
sheep(101108502) aldehyde dehydrogenase 3 family, member A1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000691 Rosetta Predictions human pricing
NM_031972 Rosetta Predictions rat pricing
NM_001112725 Rosetta Predictions mouse pricing
NM_007436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028437 predicted 576
2 SASI_Hs01_00028438 predicted 686
3 SASI_Hs01_00028439 predicted 879
4 SASI_Hs01_00028440 predicted 1131
5 SASI_Hs01_00028441 predicted 430
6 SASI_Hs01_00028442 predicted 516
7 SASI_Hs01_00028443 predicted 317
8 SASI_Hs01_00028444 predicted 1026
9 SASI_Hs01_00028445 predicted 916
10 SASI_Hs02_00303094 predicted 1139
11 SASI_Hs01_00028446 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067519 predicted 1366
2 SASI_Rn01_00067520 predicted 909
3 SASI_Rn01_00067521 predicted 1222
4 SASI_Rn02_00265361 predicted 717
5 SASI_Rn01_00067522 predicted 384
6 SASI_Rn01_00067523 predicted 1002
7 SASI_Rn01_00067524 predicted 626
8 SASI_Rn01_00067525 predicted 940
9 SASI_Rn01_00067526 predicted 703
10 SASI_Rn01_00067527 predicted 1054
11 SASI_Rn01_00067528 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307033 predicted 921
2 SASI_Mm02_00307034 predicted 249
3 SASI_Mm02_00307035 predicted 817
4 SASI_Mm02_00307036 predicted 1089
5 SASI_Mm02_00307037 predicted 244
6 SASI_Mm02_00307038 predicted 783
7 SASI_Mm02_00307039 predicted 388
8 SASI_Mm02_00307040 predicted 247
9 SASI_Mm02_00307041 predicted 806
10 SASI_Mm02_00307042 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133811 predicted 1054
2 SASI_Mm01_00133812 predicted 372
3 SASI_Mm02_00311595 predicted 942
4 SASI_Mm01_00133814 predicted 1219
5 SASI_Mm02_00311596 predicted 379
6 SASI_Mm01_00133816 predicted 909
7 SASI_Mm01_00133817 predicted 519
8 SASI_Mm02_00311597 predicted 377
9 SASI_Mm02_00311598 predicted 929
10 SASI_Mm01_00133820 predicted 1265
11 SASI_Mm01_00133813 predicted 323
12 SASI_Mm01_00133815 predicted 1219
13 SASI_Mm01_00133818 predicted 628
14 SASI_Mm01_00133819 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007436
ALDH3A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member A1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1045s21c1
Sequence:CCGGCACTTCCAGCGGGTCATAAATCTCGAGATTTATGACCCGCTGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1216s21c1
Sequence:CCGGAGCTTGGATGAGGCCATTAAACTCGAGTTTAATGGCCTCATCCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-511s21c1
Sequence:CCGGGGTGCTTGGAACTACCCATTCCTCGAGGAATGGGTAGTTCCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007436.1-1569s1c1
Sequence:CCGGGCTGTCCTGTCCTTGAAGAATCTCGAGATTCTTCAAGGACAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-276s1c1
Sequence:CCGGGCGCATGATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-934s1c1
Sequence:CCGGCCCTCCATTCAGAATGAAATTCTCGAGAATTTCATTCTGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-637s1c1
Sequence:CCGGCCTCAGTATATGGACAAGGATCTCGAGATCCTTGTCCATATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-1473s1c1
Sequence:CCGGGCGGAATGAAGAAGCTAACAACTCGAGTTGTTAGCTTCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007436
ALDH3A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member A1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1045s21c1
Sequence:CCGGCACTTCCAGCGGGTCATAAATCTCGAGATTTATGACCCGCTGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1216s21c1
Sequence:CCGGAGCTTGGATGAGGCCATTAAACTCGAGTTTAATGGCCTCATCCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-511s21c1
Sequence:CCGGGGTGCTTGGAACTACCCATTCCTCGAGGAATGGGTAGTTCCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007436.1-1569s1c1
Sequence:CCGGGCTGTCCTGTCCTTGAAGAATCTCGAGATTCTTCAAGGACAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-276s1c1
Sequence:CCGGGCGCATGATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-934s1c1
Sequence:CCGGCCCTCCATTCAGAATGAAATTCTCGAGAATTTCATTCTGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-637s1c1
Sequence:CCGGCCTCAGTATATGGACAAGGATCTCGAGATCCTTGTCCATATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-1473s1c1
Sequence:CCGGGCGGAATGAAGAAGCTAACAACTCGAGTTGTTAGCTTCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007436
ALDH3A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member A1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1045s21c1
Sequence:CCGGCACTTCCAGCGGGTCATAAATCTCGAGATTTATGACCCGCTGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-1216s21c1
Sequence:CCGGAGCTTGGATGAGGCCATTAAACTCGAGTTTAATGGCCTCATCCAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007436.2-511s21c1
Sequence:CCGGGGTGCTTGGAACTACCCATTCCTCGAGGAATGGGTAGTTCCAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007436.1-1569s1c1
Sequence:CCGGGCTGTCCTGTCCTTGAAGAATCTCGAGATTCTTCAAGGACAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-276s1c1
Sequence:CCGGGCGCATGATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-934s1c1
Sequence:CCGGCCCTCCATTCAGAATGAAATTCTCGAGAATTTCATTCTGAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-637s1c1
Sequence:CCGGCCTCAGTATATGGACAAGGATCTCGAGATCCTTGTCCATATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007436.1-1473s1c1
Sequence:CCGGGCGGAATGAAGAAGCTAACAACTCGAGTTGTTAGCTTCTTCATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000691
VALIDATED
ALDH3A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-657s21c1
Sequence:CCGGCAAGGATCTGTACCCAGTAATCTCGAGATTACTGGGTACAGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-1489s21c1
Sequence:CCGGGAAGGCCTGAAGGTCAGATACCTCGAGGTATCTGACCTTCAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-966s21c1
Sequence:CCGGGAAGCTCAAGAAGTCACTGAACTCGAGTTCAGTGACTTCTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-711s21c1
Sequence:CCGGCAAGGAGAGGTTCGACCATATCTCGAGATATGGTCGAACCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-195s1c1
Sequence:CCGGCCTGCACAAGAATGAATGGAACTCGAGTTCCATTCATTCTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-1152s1c1
Sequence:CCGGCGACAAGGTGATTAAGAAGATCTCGAGATCTTCTTAATCACCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-868s1c1
Sequence:CCGGGCTAAGAAATCCCGGGACTATCTCGAGATAGTCCCGGGATTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-243s1c1
Sequence:CCGGCCTAGAGGAGATCGAGTACATCTCGAGATGTACTCGATCTCCTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-802s1c1
Sequence:CCGGCCCTCGATCCAGAACCAAATTCTCGAGAATTTGGTTCTGGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000691
VALIDATED
ALDH3A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-657s21c1
Sequence:CCGGCAAGGATCTGTACCCAGTAATCTCGAGATTACTGGGTACAGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-1489s21c1
Sequence:CCGGGAAGGCCTGAAGGTCAGATACCTCGAGGTATCTGACCTTCAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-966s21c1
Sequence:CCGGGAAGCTCAAGAAGTCACTGAACTCGAGTTCAGTGACTTCTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-711s21c1
Sequence:CCGGCAAGGAGAGGTTCGACCATATCTCGAGATATGGTCGAACCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-195s1c1
Sequence:CCGGCCTGCACAAGAATGAATGGAACTCGAGTTCCATTCATTCTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-1152s1c1
Sequence:CCGGCGACAAGGTGATTAAGAAGATCTCGAGATCTTCTTAATCACCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-868s1c1
Sequence:CCGGGCTAAGAAATCCCGGGACTATCTCGAGATAGTCCCGGGATTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-243s1c1
Sequence:CCGGCCTAGAGGAGATCGAGTACATCTCGAGATGTACTCGATCTCCTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-802s1c1
Sequence:CCGGCCCTCGATCCAGAACCAAATTCTCGAGAATTTGGTTCTGGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000691
VALIDATED
ALDH3A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-657s21c1
Sequence:CCGGCAAGGATCTGTACCCAGTAATCTCGAGATTACTGGGTACAGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-1489s21c1
Sequence:CCGGGAAGGCCTGAAGGTCAGATACCTCGAGGTATCTGACCTTCAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-966s21c1
Sequence:CCGGGAAGCTCAAGAAGTCACTGAACTCGAGTTCAGTGACTTCTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000691.4-711s21c1
Sequence:CCGGCAAGGAGAGGTTCGACCATATCTCGAGATATGGTCGAACCTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-195s1c1
Sequence:CCGGCCTGCACAAGAATGAATGGAACTCGAGTTCCATTCATTCTTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-1152s1c1
Sequence:CCGGCGACAAGGTGATTAAGAAGATCTCGAGATCTTCTTAATCACCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-868s1c1
Sequence:CCGGGCTAAGAAATCCCGGGACTATCTCGAGATAGTCCCGGGATTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000691.3-243s1c1
Sequence:CCGGCCTAGAGGAGATCGAGTACATCTCGAGATGTACTCGATCTCCTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000691.3-802s1c1
Sequence:CCGGCCCTCGATCCAGAACCAAATTCTCGAGAATTTGGTTCTGGATCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks