EMAIL THIS PAGE TO A FRIEND

ALDH3A2

aldehyde dehydrogenase 3 family, member A2

80 Gene Product Result for
Synonyms: ALDH10 FALDH SLS
UniProtKB ID: P51648, Q6I9T3, Q93011, Q96J37
Gene ID:
Human(224) Summary: Aldehyde dehydrogenase isozymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This gene product catalyzes the oxidation of long-chain aliphatic aldehydes to fatty acid. Mutations in the gene cause Sjogren-Larsson syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11671) aldehyde dehydrogenase family 3, subfamily A2
Rat(65183) aldehyde dehydrogenase 3 family, member A2
sheep(101118798) aldehyde dehydrogenase 3 family, member A2
Domestic Rabbit(100338784) aldehyde dehydrogenase 3 family, member A2
domestic guinea pig(100728950) aldehyde dehydrogenase 3 family, member A2
naked mole-rat(101711406) aldehyde dehydrogenase 3 family, member A2
chicken(417615) aldehyde dehydrogenase 3 family, member A2
domestic cat(101096617) aldehyde dehydrogenase 3 family, member A2
cow(513967) aldehyde dehydrogenase 3 family, member A2
Horse(100073165) aldehyde dehydrogenase 3 family, member A2
dog(479518) aldehyde dehydrogenase 3 family, member A2
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000382 Rosetta Predictions human pricing
NM_001031806 Rosetta Predictions human pricing
NM_031731 Rosetta Predictions rat pricing
XM_579525 Rosetta Predictions rat pricing
NM_007437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012071 predicted 951
2 SASI_Hs01_00012072 predicted 1133
3 SASI_Hs02_00302451 predicted 939
4 SASI_Hs01_00012073 predicted 1165
5 SASI_Hs01_00012074 predicted 690
6 SASI_Hs01_00012075 predicted 1057
7 SASI_Hs01_00012076 predicted 766
8 SASI_Hs01_00012077 predicted 447
9 SASI_Hs01_00012079 predicted 1054
10 SASI_Hs01_00012080 predicted 932
11 SASI_Hs01_00012078 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110440 predicted 948
2 SASI_Hs01_00110441 predicted 1135
3 SASI_Hs02_00307818 predicted 934
4 SASI_Hs01_00110442 predicted 1160
5 SASI_Hs01_00110443 predicted 684
6 SASI_Hs01_00110444 predicted 1057
7 SASI_Hs01_00110445 predicted 771
8 SASI_Hs01_00110446 predicted 442
9 SASI_Hs01_00110448 predicted 1059
10 SASI_Hs01_00110449 predicted 932
11 SASI_Hs01_00110447 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265113 predicted 846
2 SASI_Rn01_00033988 predicted 821
3 SASI_Rn01_00033989 predicted 1337
4 SASI_Rn01_00033990 predicted 1115
5 SASI_Rn01_00033991 predicted 1557
6 SASI_Rn01_00033992 predicted 1286
7 SASI_Rn01_00033993 predicted 957
8 SASI_Rn02_00265114 predicted 276
9 SASI_Rn01_00033996 predicted 494
10 SASI_Rn01_00033997 predicted 278
11 SASI_Rn01_00033994 predicted 888
12 SASI_Rn01_00033995 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179688 predicted 298
2 SASI_Rn01_00179689 predicted 1351
3 SASI_Rn01_00179690 predicted 1124
4 SASI_Rn01_00179691 predicted 1578
5 SASI_Rn01_00179692 predicted 1297
6 SASI_Rn01_00179693 predicted 507
7 SASI_Rn01_00179694 predicted 1623
8 SASI_Rn01_00179695 predicted 1163
9 SASI_Rn01_00179696 predicted 1245
10 SASI_Rn01_00179697 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186620 predicted 1560
2 SASI_Mm01_00186621 predicted 1547
3 SASI_Mm01_00186622 predicted 337
4 SASI_Mm01_00186623 predicted 1604
5 SASI_Mm01_00186624 predicted 850
6 SASI_Mm01_00186625 predicted 950
7 SASI_Mm01_00186626 predicted 562
8 SASI_Mm01_00186627 predicted 1618
9 SASI_Mm01_00186628 predicted 972
10 SASI_Mm01_00186629 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007437
ALDH3A2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member A2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007437.1-2070s1c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-1209s1c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-507s1c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-843s1c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-969s1c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-851s21c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-515s21c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-977s21c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-1217s21c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007437.4-2086s21c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007437
ALDH3A2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member A2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007437.1-2070s1c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-1209s1c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-507s1c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-843s1c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-969s1c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-851s21c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-515s21c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-977s21c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-1217s21c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007437.4-2086s21c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007437
ALDH3A2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member A2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007437.1-2070s1c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-1209s1c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-507s1c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-843s1c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007437.1-969s1c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-851s21c1
Sequence:CCGGCCTGACTATATCCTGTGCGAACTCGAGTTCGCACAGGATATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-515s21c1
Sequence:CCGGGCCATTGTTAAGCCCTCAGAACTCGAGTTCTGAGGGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-977s21c1
Sequence:CCGGCGTCACTTTAAGAGGTTACAACTCGAGTTGTAACCTCTTAAAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007437.4-1217s21c1
Sequence:CCGGCGTAACAATAAGCTCATCAAACTCGAGTTTGATGAGCTTATTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007437.4-2086s21c1
Sequence:CCGGCCACCCAAAGTCTGTGTGTTTCTCGAGAAACACACAGACTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000382
VALIDATED
ALDH3A2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member A2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-921s1c1
Sequence:CCGGCCCGACTATATTCTCTGTGAACTCGAGTTCACAGAGAATATAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-573s1c1
Sequence:CCGGGCAGGAAATGCTGTGATTATACTCGAGTATAATCACAGCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1286s1c1
Sequence:CCGGGCATAACCATAAGCTCATCAACTCGAGTTGATGAGCTTATGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1263s1c1
Sequence:CCGGCCTCTGGCTCTTTATGTATTTCTCGAGAAATACATAAAGAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-332s1c1
Sequence:CCGGCGACCTGTGCAAGAGTGAATTCTCGAGAATTCACTCTTGCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000382
VALIDATED
ALDH3A2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member A2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-921s1c1
Sequence:CCGGCCCGACTATATTCTCTGTGAACTCGAGTTCACAGAGAATATAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-573s1c1
Sequence:CCGGGCAGGAAATGCTGTGATTATACTCGAGTATAATCACAGCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1286s1c1
Sequence:CCGGGCATAACCATAAGCTCATCAACTCGAGTTGATGAGCTTATGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1263s1c1
Sequence:CCGGCCTCTGGCTCTTTATGTATTTCTCGAGAAATACATAAAGAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-332s1c1
Sequence:CCGGCGACCTGTGCAAGAGTGAATTCTCGAGAATTCACTCTTGCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000382
VALIDATED
ALDH3A2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member A2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-921s1c1
Sequence:CCGGCCCGACTATATTCTCTGTGAACTCGAGTTCACAGAGAATATAGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-573s1c1
Sequence:CCGGGCAGGAAATGCTGTGATTATACTCGAGTATAATCACAGCATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1286s1c1
Sequence:CCGGGCATAACCATAAGCTCATCAACTCGAGTTGATGAGCTTATGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-1263s1c1
Sequence:CCGGCCTCTGGCTCTTTATGTATTTCTCGAGAAATACATAAAGAGCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000382.1-332s1c1
Sequence:CCGGCGACCTGTGCAAGAGTGAATTCTCGAGAATTCACTCTTGCACAGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks