EMAIL THIS PAGE TO A FRIEND

ALDH3B1

aldehyde dehydrogenase 3 family, member B1

Synonyms: ALDH4 ALDH7
UniProtKB ID: P43353, A3FMP9, Q53XL5, Q8N515, Q96CK8
Gene ID:
Human(221) Summary: The aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular gene spans about 20 kb of genomic DNA and is composed of 9 coding exons. The gene is highly expressed in kidney and lung. The functional significance of this gene as well as the cellular localization of its product are presently unknown. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(67689) aldehyde dehydrogenase 3 family, member B1
Rat(309147) aldehyde dehydrogenase 3 family, member B1
Zebrafish(282559) aldehyde dehydrogenase 3 family, member B1
cow(511469) aldehyde dehydrogenase 3 family, member B1
Horse(100053339) aldehyde dehydrogenase 3 family, member B1
domestic cat(101094208) aldehyde dehydrogenase 3 family, member B1
dog(476003) aldehyde dehydrogenase 3 family, member B1
chicken(428813) aldehyde dehydrogenase 3 family, member B1
naked mole-rat(101722793) aldehyde dehydrogenase 3 family, member B1
domestic guinea pig(100726747) aldehyde dehydrogenase 3 family, member B1
sheep(101112687) aldehyde dehydrogenase 3 family, member B1
Gene Class: Dehydrogenase
221 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000694 Rosetta Predictions human pricing
NM_001030010 Rosetta Predictions human pricing
NM_001006998 Rosetta Predictions rat pricing
NM_026316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218591 predicted 604
2 SASI_Hs01_00218592 predicted 994
3 SASI_Hs01_00218593 predicted 1235
4 SASI_Hs01_00218594 predicted 596
5 SASI_Hs01_00218595 predicted 1106
6 SASI_Hs01_00218596 predicted 603
7 SASI_Hs01_00218597 predicted 467
8 SASI_Hs01_00218598 predicted 1493
9 SASI_Hs01_00218599 predicted 236
10 SASI_Hs01_00218600 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056635 predicted 493
2 SASI_Hs01_00056636 predicted 883
3 SASI_Hs01_00056637 predicted 1125
4 SASI_Hs01_00056638 predicted 488
5 SASI_Hs01_00056639 predicted 997
6 SASI_Hs01_00056640 predicted 495
7 SASI_Hs01_00056641 predicted 356
8 SASI_Hs01_00056642 predicted 365
9 SASI_Hs01_00056643 predicted 1384
10 SASI_Hs01_00056644 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070013 predicted 268
2 SASI_Rn02_00198581 predicted 1600
3 SASI_Rn01_00070015 predicted 193
4 SASI_Rn02_00198582 predicted 439
5 SASI_Rn01_00070019 predicted 573
6 SASI_Rn01_00070020 predicted 598
7 SASI_Rn01_00070021 predicted 601
8 SASI_Rn01_00070022 predicted 211
9 SASI_Rn02_00198583 predicted 1615
10 SASI_Rn02_00198584 predicted 1371
11 SASI_Rn01_00070014 predicted 1071
12 SASI_Rn01_00070016 predicted 995
13 SASI_Rn01_00070017 predicted 1202
14 SASI_Rn01_00070018 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330020 predicted 255
2 SASI_Mm01_00100344 predicted 358
3 SASI_Mm01_00100346 predicted 577
4 SASI_Mm01_00100347 predicted 1127
5 SASI_Mm01_00100348 predicted 278
6 SASI_Mm01_00100349 predicted 1595
7 SASI_Mm01_00100350 predicted 879
8 SASI_Mm01_00100351 predicted 1348
9 SASI_Mm01_00100352 predicted 581
10 SASI_Mm01_00100353 predicted 281
11 SASI_Mm01_00100345 predicted 1607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026316
ALDH3B1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member B1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1689s21c1
Sequence:CCGGGATAATCGGCACAGGTCATACCTCGAGGTATGACCTGTGCCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1575s21c1
Sequence:CCGGAGATAGGCTGAGGGTAGGAAGCTCGAGCTTCCTACCCTCAGCCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-554s21c1
Sequence:CCGGGAACACAAGTTCGACTACATCCTCGAGGATGTAGTCGAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1655s21c1
Sequence:CCGGCACCCTCTCGTGGATAGTGTTCTCGAGAACACTATCCACGAGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-718s21c1
Sequence:CCGGGGCCTGGTTCCGCTACTTTAACTCGAGTTAAAGTAGCGGAACCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026316.2-1613s1c1
Sequence:CCGGGACCATAGAATCTTCGAGAAACTCGAGTTTCTCGAAGATTCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-358s1c1
Sequence:CCGGGCCCTGGAATTATCCCATTAACTCGAGTTAATGGGATAATTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-586s1c1
Sequence:CCGGGAATGCTTATGTAGGCAAGATCTCGAGATCTTGCCTACATAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-1135s1c1
Sequence:CCGGCCAGGTTATCAAACAGGTGTTCTCGAGAACACCTGTTTGATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026316
ALDH3B1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member B1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1689s21c1
Sequence:CCGGGATAATCGGCACAGGTCATACCTCGAGGTATGACCTGTGCCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1575s21c1
Sequence:CCGGAGATAGGCTGAGGGTAGGAAGCTCGAGCTTCCTACCCTCAGCCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-554s21c1
Sequence:CCGGGAACACAAGTTCGACTACATCCTCGAGGATGTAGTCGAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1655s21c1
Sequence:CCGGCACCCTCTCGTGGATAGTGTTCTCGAGAACACTATCCACGAGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-718s21c1
Sequence:CCGGGGCCTGGTTCCGCTACTTTAACTCGAGTTAAAGTAGCGGAACCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026316.2-1613s1c1
Sequence:CCGGGACCATAGAATCTTCGAGAAACTCGAGTTTCTCGAAGATTCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-358s1c1
Sequence:CCGGGCCCTGGAATTATCCCATTAACTCGAGTTAATGGGATAATTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-586s1c1
Sequence:CCGGGAATGCTTATGTAGGCAAGATCTCGAGATCTTGCCTACATAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-1135s1c1
Sequence:CCGGCCAGGTTATCAAACAGGTGTTCTCGAGAACACCTGTTTGATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026316
ALDH3B1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member B1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1689s21c1
Sequence:CCGGGATAATCGGCACAGGTCATACCTCGAGGTATGACCTGTGCCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1575s21c1
Sequence:CCGGAGATAGGCTGAGGGTAGGAAGCTCGAGCTTCCTACCCTCAGCCTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-554s21c1
Sequence:CCGGGAACACAAGTTCGACTACATCCTCGAGGATGTAGTCGAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026316.2-1655s21c1
Sequence:CCGGCACCCTCTCGTGGATAGTGTTCTCGAGAACACTATCCACGAGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026316.2-718s21c1
Sequence:CCGGGGCCTGGTTCCGCTACTTTAACTCGAGTTAAAGTAGCGGAACCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026316.2-1613s1c1
Sequence:CCGGGACCATAGAATCTTCGAGAAACTCGAGTTTCTCGAAGATTCTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-358s1c1
Sequence:CCGGGCCCTGGAATTATCCCATTAACTCGAGTTAATGGGATAATTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-586s1c1
Sequence:CCGGGAATGCTTATGTAGGCAAGATCTCGAGATCTTGCCTACATAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026316.2-1135s1c1
Sequence:CCGGCCAGGTTATCAAACAGGTGTTCTCGAGAACACCTGTTTGATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000694
VALIDATED
ALDH3B1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member B1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-461s1c1
Sequence:CCGGGCCATCGGAGATTAGCAAGAACTCGAGTTCTTGCTAATCTCCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000694.1-285s1c1
Sequence:CCGGGCCTGGATGAAGGACGAGCGTCTCGAGACGCTCGTCCTTCATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-219s1c1
Sequence:CCGGGAGTCGGAGGTGTCTGAGGTTCTCGAGAACCTCAGACACCTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-470s1c1
Sequence:CCGGGATTAGCAAGAACGTCGAGAACTCGAGTTCTCGACGTTCTTGCTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000694
VALIDATED
ALDH3B1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member B1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-461s1c1
Sequence:CCGGGCCATCGGAGATTAGCAAGAACTCGAGTTCTTGCTAATCTCCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000694.1-285s1c1
Sequence:CCGGGCCTGGATGAAGGACGAGCGTCTCGAGACGCTCGTCCTTCATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-219s1c1
Sequence:CCGGGAGTCGGAGGTGTCTGAGGTTCTCGAGAACCTCAGACACCTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-470s1c1
Sequence:CCGGGATTAGCAAGAACGTCGAGAACTCGAGTTCTCGACGTTCTTGCTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000694
VALIDATED
ALDH3B1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member B1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-461s1c1
Sequence:CCGGGCCATCGGAGATTAGCAAGAACTCGAGTTCTTGCTAATCTCCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000694.1-285s1c1
Sequence:CCGGGCCTGGATGAAGGACGAGCGTCTCGAGACGCTCGTCCTTCATCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-219s1c1
Sequence:CCGGGAGTCGGAGGTGTCTGAGGTTCTCGAGAACCTCAGACACCTCCGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000694.1-470s1c1
Sequence:CCGGGATTAGCAAGAACGTCGAGAACTCGAGTTCTCGACGTTCTTGCTAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks